Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632492_at:

>probe:Drosophila_2:1632492_at:371:227; Interrogation_Position=1576; Antisense; AAGGCCTGCTTCTATGTGCAACGTG
>probe:Drosophila_2:1632492_at:114:35; Interrogation_Position=1678; Antisense; ATCAAAAAGGCCTGTCTGCGCTCCA
>probe:Drosophila_2:1632492_at:542:629; Interrogation_Position=1699; Antisense; TCCAGTGTCTCGTGCCAAATCGAAG
>probe:Drosophila_2:1632492_at:563:435; Interrogation_Position=1753; Antisense; GAGGAGGAACACTTGGCCTTCGAAA
>probe:Drosophila_2:1632492_at:120:457; Interrogation_Position=1816; Antisense; GATACGGTGATCACAGTCAAACTGG
>probe:Drosophila_2:1632492_at:465:665; Interrogation_Position=1847; Antisense; TACAAAAGCGCGGATGTCTGCCCAA
>probe:Drosophila_2:1632492_at:562:61; Interrogation_Position=1860; Antisense; ATGTCTGCCCAATTTGGCGGTGCAA
>probe:Drosophila_2:1632492_at:131:235; Interrogation_Position=1883; Antisense; AATCGCTAAAGGGTCGTGTCGCCAA
>probe:Drosophila_2:1632492_at:210:501; Interrogation_Position=1895; Antisense; GTCGTGTCGCCAATGCTGGCAACAA
>probe:Drosophila_2:1632492_at:211:207; Interrogation_Position=1924; Antisense; AAGCTGGGCGCTGAATTCACTTAGA
>probe:Drosophila_2:1632492_at:143:165; Interrogation_Position=1965; Antisense; AAATCCATCCATAGACAGACAGCAT
>probe:Drosophila_2:1632492_at:330:399; Interrogation_Position=1978; Antisense; GACAGACAGCATCAAACACGCGCAC
>probe:Drosophila_2:1632492_at:224:443; Interrogation_Position=2077; Antisense; GATGACTTTTCGAGCTTGGCGGAAT
>probe:Drosophila_2:1632492_at:395:685; Interrogation_Position=2092; Antisense; TTGGCGGAATTAAAACTTGCAGCAC

Paste this into a BLAST search page for me
AAGGCCTGCTTCTATGTGCAACGTGATCAAAAAGGCCTGTCTGCGCTCCATCCAGTGTCTCGTGCCAAATCGAAGGAGGAGGAACACTTGGCCTTCGAAAGATACGGTGATCACAGTCAAACTGGTACAAAAGCGCGGATGTCTGCCCAAATGTCTGCCCAATTTGGCGGTGCAAAATCGCTAAAGGGTCGTGTCGCCAAGTCGTGTCGCCAATGCTGGCAACAAAAGCTGGGCGCTGAATTCACTTAGAAAATCCATCCATAGACAGACAGCATGACAGACAGCATCAAACACGCGCACGATGACTTTTCGAGCTTGGCGGAATTTGGCGGAATTAAAACTTGCAGCAC

Full Affymetrix probeset data:

Annotations for 1632492_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime