Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632494_at:

>probe:Drosophila_2:1632494_at:201:475; Interrogation_Position=3989; Antisense; GTTACCAGGAGGAAATCGGTGACCT
>probe:Drosophila_2:1632494_at:172:291; Interrogation_Position=4005; Antisense; CGGTGACCTGATTTGTATTATTAAC
>probe:Drosophila_2:1632494_at:125:223; Interrogation_Position=4045; Antisense; AAGGTATCTGGGAACCATACTGGTT
>probe:Drosophila_2:1632494_at:121:203; Interrogation_Position=4057; Antisense; AACCATACTGGTTCCTCAATGGAGG
>probe:Drosophila_2:1632494_at:383:565; Interrogation_Position=4114; Antisense; GGAATTTATCTTGCCATTAAGCTGA
>probe:Drosophila_2:1632494_at:477:659; Interrogation_Position=4131; Antisense; TAAGCTGAGCTTAGAACATTTTAAA
>probe:Drosophila_2:1632494_at:114:705; Interrogation_Position=4162; Antisense; TTATGCATGCATGGCGTCTCCTAAA
>probe:Drosophila_2:1632494_at:597:493; Interrogation_Position=4177; Antisense; GTCTCCTAAATGTAAAGCTTCGGTG
>probe:Drosophila_2:1632494_at:152:571; Interrogation_Position=4220; Antisense; GGCATTTATTTCTTAGTACTATTTC
>probe:Drosophila_2:1632494_at:128:653; Interrogation_Position=4287; Antisense; TAATTTTCAAATAACCGGCTCAAAT
>probe:Drosophila_2:1632494_at:211:655; Interrogation_Position=4352; Antisense; TAATTGAACTCGTATTAAATGCCGA
>probe:Drosophila_2:1632494_at:701:203; Interrogation_Position=4496; Antisense; AACCAATGTCGACATGATTTCTTGA
>probe:Drosophila_2:1632494_at:205:459; Interrogation_Position=4511; Antisense; GATTTCTTGAAACTGTTGATTCGAA
>probe:Drosophila_2:1632494_at:323:63; Interrogation_Position=4547; Antisense; ATGTGCTTATTTATGTATGTCTTAC

Paste this into a BLAST search page for me
GTTACCAGGAGGAAATCGGTGACCTCGGTGACCTGATTTGTATTATTAACAAGGTATCTGGGAACCATACTGGTTAACCATACTGGTTCCTCAATGGAGGGGAATTTATCTTGCCATTAAGCTGATAAGCTGAGCTTAGAACATTTTAAATTATGCATGCATGGCGTCTCCTAAAGTCTCCTAAATGTAAAGCTTCGGTGGGCATTTATTTCTTAGTACTATTTCTAATTTTCAAATAACCGGCTCAAATTAATTGAACTCGTATTAAATGCCGAAACCAATGTCGACATGATTTCTTGAGATTTCTTGAAACTGTTGATTCGAAATGTGCTTATTTATGTATGTCTTAC

Full Affymetrix probeset data:

Annotations for 1632494_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime