FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632495_at:

>probe:Drosophila_2:1632495_at:542:489; Interrogation_Position=256; Antisense; GTCCATTGTTTTCCGGTTTTGCCAT
>probe:Drosophila_2:1632495_at:222:65; Interrogation_Position=279; Antisense; ATGGGTGCCATGTTCTACGGCTATG
>probe:Drosophila_2:1632495_at:620:681; Interrogation_Position=300; Antisense; TATGGTTTGATACACCTGCCCAGCA
>probe:Drosophila_2:1632495_at:714:187; Interrogation_Position=359; Antisense; AACAGCTGGCTTGTCCGTGTGGCAA
>probe:Drosophila_2:1632495_at:304:231; Interrogation_Position=385; Antisense; AATGTAGTCCCGTGATGCTTGTGCC
>probe:Drosophila_2:1632495_at:458:659; Interrogation_Position=436; Antisense; TAAGCCTATTCCCTTGCCATTTGTG
>probe:Drosophila_2:1632495_at:397:313; Interrogation_Position=451; Antisense; GCCATTTGTGGGAGTTTCTTGCGAA
>probe:Drosophila_2:1632495_at:501:247; Interrogation_Position=498; Antisense; AATTGTCTGCAGCACGTCATTCTGG
>probe:Drosophila_2:1632495_at:652:495; Interrogation_Position=513; Antisense; GTCATTCTGGCTTTTGTACTGTGGA
>probe:Drosophila_2:1632495_at:358:543; Interrogation_Position=535; Antisense; GGATATACCTGCTAATCCTGGCCAT
>probe:Drosophila_2:1632495_at:666:33; Interrogation_Position=558; Antisense; ATCACTAGCTTGGTCTCTGTTGTGA
>probe:Drosophila_2:1632495_at:111:97; Interrogation_Position=595; Antisense; AGATGCTGGCTGACAGGCACATTCA
>probe:Drosophila_2:1632495_at:399:567; Interrogation_Position=610; Antisense; GGCACATTCACAGCAGAGACCACGA
>probe:Drosophila_2:1632495_at:396:531; Interrogation_Position=710; Antisense; GGGTACCTACAAGCATTTTCCATAA

Paste this into a BLAST search page for me
GTCCATTGTTTTCCGGTTTTGCCATATGGGTGCCATGTTCTACGGCTATGTATGGTTTGATACACCTGCCCAGCAAACAGCTGGCTTGTCCGTGTGGCAAAATGTAGTCCCGTGATGCTTGTGCCTAAGCCTATTCCCTTGCCATTTGTGGCCATTTGTGGGAGTTTCTTGCGAAAATTGTCTGCAGCACGTCATTCTGGGTCATTCTGGCTTTTGTACTGTGGAGGATATACCTGCTAATCCTGGCCATATCACTAGCTTGGTCTCTGTTGTGAAGATGCTGGCTGACAGGCACATTCAGGCACATTCACAGCAGAGACCACGAGGGTACCTACAAGCATTTTCCATAA

Full Affymetrix probeset data:

Annotations for 1632495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720