FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632496_at:

>probe:Drosophila_2:1632496_at:14:401; Interrogation_Position=113; Antisense; GACAGCAGTGGCCAATTTTCCGAAG
>probe:Drosophila_2:1632496_at:558:339; Interrogation_Position=203; Antisense; GCTAGCCAAGCTTTTTCCCAAGGAG
>probe:Drosophila_2:1632496_at:675:59; Interrogation_Position=240; Antisense; ATGTGTTTAACAATCCCTTCCTGGA
>probe:Drosophila_2:1632496_at:33:719; Interrogation_Position=257; Antisense; TTCCTGGAGGCCGAGCTGCATAAAA
>probe:Drosophila_2:1632496_at:225:119; Interrogation_Position=270; Antisense; AGCTGCATAAAACCGCGTCGCTGGA
>probe:Drosophila_2:1632496_at:474:225; Interrogation_Position=341; Antisense; AATGGCCGTAAGATTTGCTGGAACT
>probe:Drosophila_2:1632496_at:320:129; Interrogation_Position=392; Antisense; ACCAGTTGCCAGTATGCTCACGATT
>probe:Drosophila_2:1632496_at:580:375; Interrogation_Position=445; Antisense; GAAGAGTGCATTACCGGATCAATCA
>probe:Drosophila_2:1632496_at:15:545; Interrogation_Position=460; Antisense; GGATCAATCAGTGCCTGTGGTCGTA
>probe:Drosophila_2:1632496_at:269:499; Interrogation_Position=479; Antisense; GTCGTAGAAGCTGCACCGGGTAATT
>probe:Drosophila_2:1632496_at:186:343; Interrogation_Position=491; Antisense; GCACCGGGTAATTTCAACAGGCGTA
>probe:Drosophila_2:1632496_at:17:255; Interrogation_Position=587; Antisense; CAAAATCCATTTGCCCGGCGTTAGA
>probe:Drosophila_2:1632496_at:377:619; Interrogation_Position=619; Antisense; TGCATCCGTGATGCGCAGCAGACAG
>probe:Drosophila_2:1632496_at:453:85; Interrogation_Position=642; Antisense; AGTGCTCACCATCAGGGCCATATGT

Paste this into a BLAST search page for me
GACAGCAGTGGCCAATTTTCCGAAGGCTAGCCAAGCTTTTTCCCAAGGAGATGTGTTTAACAATCCCTTCCTGGATTCCTGGAGGCCGAGCTGCATAAAAAGCTGCATAAAACCGCGTCGCTGGAAATGGCCGTAAGATTTGCTGGAACTACCAGTTGCCAGTATGCTCACGATTGAAGAGTGCATTACCGGATCAATCAGGATCAATCAGTGCCTGTGGTCGTAGTCGTAGAAGCTGCACCGGGTAATTGCACCGGGTAATTTCAACAGGCGTACAAAATCCATTTGCCCGGCGTTAGATGCATCCGTGATGCGCAGCAGACAGAGTGCTCACCATCAGGGCCATATGT

Full Affymetrix probeset data:

Annotations for 1632496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720