FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632498_at:

>probe:Drosophila_2:1632498_at:436:227; Interrogation_Position=1014; Antisense; AAGGCCCATGGCTATGATCAAATCC
>probe:Drosophila_2:1632498_at:195:231; Interrogation_Position=1040; Antisense; AATGAGTTTGATCTGCCCGTACTAC
>probe:Drosophila_2:1632498_at:119:445; Interrogation_Position=1100; Antisense; GATGATGCCCATGCTGGAGCCGCAG
>probe:Drosophila_2:1632498_at:633:649; Interrogation_Position=1210; Antisense; TCAAATGTCTTTTGCCCGCCAAAAT
>probe:Drosophila_2:1632498_at:475:47; Interrogation_Position=1260; Antisense; ATCCGTGGACCCGAGTCTATGATGA
>probe:Drosophila_2:1632498_at:15:503; Interrogation_Position=1305; Antisense; GTCGCCGCTGGTTAAACACACAATA
>probe:Drosophila_2:1632498_at:25:331; Interrogation_Position=1380; Antisense; GCGGCATCGTTTCACCTATAATTTT
>probe:Drosophila_2:1632498_at:457:37; Interrogation_Position=837; Antisense; ATCATATCGCACTACTGGACCGTGA
>probe:Drosophila_2:1632498_at:543:391; Interrogation_Position=860; Antisense; GAAAGCGTTTCTGCCTCACATGATG
>probe:Drosophila_2:1632498_at:408:519; Interrogation_Position=895; Antisense; GTGGTCATATCGTTACTGTGGGCTC
>probe:Drosophila_2:1632498_at:352:329; Interrogation_Position=916; Antisense; GCTCGGTAACTGGAATGCTGGGCAC
>probe:Drosophila_2:1632498_at:49:671; Interrogation_Position=942; Antisense; TACGGATGCAGTGACTACGCGGCCA
>probe:Drosophila_2:1632498_at:429:347; Interrogation_Position=979; Antisense; GCATCGGTTTCCACGAGAGTTTGCT
>probe:Drosophila_2:1632498_at:217:101; Interrogation_Position=994; Antisense; AGAGTTTGCTCACCGATCTGAAGGC

Paste this into a BLAST search page for me
AAGGCCCATGGCTATGATCAAATCCAATGAGTTTGATCTGCCCGTACTACGATGATGCCCATGCTGGAGCCGCAGTCAAATGTCTTTTGCCCGCCAAAATATCCGTGGACCCGAGTCTATGATGAGTCGCCGCTGGTTAAACACACAATAGCGGCATCGTTTCACCTATAATTTTATCATATCGCACTACTGGACCGTGAGAAAGCGTTTCTGCCTCACATGATGGTGGTCATATCGTTACTGTGGGCTCGCTCGGTAACTGGAATGCTGGGCACTACGGATGCAGTGACTACGCGGCCAGCATCGGTTTCCACGAGAGTTTGCTAGAGTTTGCTCACCGATCTGAAGGC

Full Affymetrix probeset data:

Annotations for 1632498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720