FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632499_at:

>probe:Drosophila_2:1632499_at:304:145; Interrogation_Position=4828; Antisense; ACTAAATCATCTTCTCAAACACCAC
>probe:Drosophila_2:1632499_at:53:189; Interrogation_Position=4845; Antisense; AACACCACCATCGATATCTACAGAA
>probe:Drosophila_2:1632499_at:47:399; Interrogation_Position=4878; Antisense; GACACAAGCAATCCAGAACCATCGA
>probe:Drosophila_2:1632499_at:471:103; Interrogation_Position=4905; Antisense; AGACGAAGCCACACAGAGTACATTA
>probe:Drosophila_2:1632499_at:246:595; Interrogation_Position=5006; Antisense; TGTCGGTGAACAGCAGGCCCTGGTT
>probe:Drosophila_2:1632499_at:584:609; Interrogation_Position=5105; Antisense; TGAGCCACGCTAACCGTTCGATCAA
>probe:Drosophila_2:1632499_at:571:471; Interrogation_Position=5120; Antisense; GTTCGATCAATCCACTAGTGTCCAG
>probe:Drosophila_2:1632499_at:240:625; Interrogation_Position=5171; Antisense; TGCCGCAGCTCATCGTTAAGGTGTA
>probe:Drosophila_2:1632499_at:83:601; Interrogation_Position=5192; Antisense; TGTACGAGCCCATCGACCTGAAGAT
>probe:Drosophila_2:1632499_at:144:375; Interrogation_Position=5211; Antisense; GAAGATCGTCTTCTGTCCGAAGTCG
>probe:Drosophila_2:1632499_at:9:415; Interrogation_Position=5251; Antisense; GACCACAAATTCGACCCAGCTGATA
>probe:Drosophila_2:1632499_at:236:657; Interrogation_Position=5280; Antisense; TAAGACGTCCAACTGCACGGGAGGC
>probe:Drosophila_2:1632499_at:667:417; Interrogation_Position=5320; Antisense; GAGCGGATCCACAAGCATGTCGACA
>probe:Drosophila_2:1632499_at:8:381; Interrogation_Position=5352; Antisense; GAAGCCACTGGAGCTGACCGACATC

Paste this into a BLAST search page for me
ACTAAATCATCTTCTCAAACACCACAACACCACCATCGATATCTACAGAAGACACAAGCAATCCAGAACCATCGAAGACGAAGCCACACAGAGTACATTATGTCGGTGAACAGCAGGCCCTGGTTTGAGCCACGCTAACCGTTCGATCAAGTTCGATCAATCCACTAGTGTCCAGTGCCGCAGCTCATCGTTAAGGTGTATGTACGAGCCCATCGACCTGAAGATGAAGATCGTCTTCTGTCCGAAGTCGGACCACAAATTCGACCCAGCTGATATAAGACGTCCAACTGCACGGGAGGCGAGCGGATCCACAAGCATGTCGACAGAAGCCACTGGAGCTGACCGACATC

Full Affymetrix probeset data:

Annotations for 1632499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720