FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632500_at:

>probe:Drosophila_2:1632500_at:264:185; Interrogation_Position=3586; Antisense; AAAATGGCCAATGCTCATGAGTTCA
>probe:Drosophila_2:1632500_at:658:57; Interrogation_Position=3602; Antisense; ATGAGTTCATTATGTCTCTGCCTGC
>probe:Drosophila_2:1632500_at:533:497; Interrogation_Position=3615; Antisense; GTCTCTGCCTGCTCAGTATGATACG
>probe:Drosophila_2:1632500_at:98:485; Interrogation_Position=3630; Antisense; GTATGATACGGTTTTGGGTTCCAAG
>probe:Drosophila_2:1632500_at:325:81; Interrogation_Position=3653; Antisense; AGGGCACCCAATTATCCGGTGGGCA
>probe:Drosophila_2:1632500_at:137:173; Interrogation_Position=3683; Antisense; AAAGAATTGCAATTGCTCGAGCGAT
>probe:Drosophila_2:1632500_at:295:473; Interrogation_Position=3778; Antisense; GTTCAACAAGCTTTGGACTCGGCAT
>probe:Drosophila_2:1632500_at:88:587; Interrogation_Position=3791; Antisense; TGGACTCGGCATGTTCAGGACGAAC
>probe:Drosophila_2:1632500_at:424:153; Interrogation_Position=3814; Antisense; ACATGTATTGTAATCGCCCATCGCC
>probe:Drosophila_2:1632500_at:420:83; Interrogation_Position=3891; Antisense; AGTGGAGCAGGGATCTCACTCCCAA
>probe:Drosophila_2:1632500_at:647:137; Interrogation_Position=3908; Antisense; ACTCCCAACTTCTGGCCAAGAATGG
>probe:Drosophila_2:1632500_at:692:569; Interrogation_Position=3931; Antisense; GGCATTTATTCCAAGCTCTATCGCT
>probe:Drosophila_2:1632500_at:334:635; Interrogation_Position=3951; Antisense; TCGCTGTCAGACGAAAGCCTCTTGA
>probe:Drosophila_2:1632500_at:321:17; Interrogation_Position=4025; Antisense; ATTTTTCTAGTACCACAATGAGGCA

Paste this into a BLAST search page for me
AAAATGGCCAATGCTCATGAGTTCAATGAGTTCATTATGTCTCTGCCTGCGTCTCTGCCTGCTCAGTATGATACGGTATGATACGGTTTTGGGTTCCAAGAGGGCACCCAATTATCCGGTGGGCAAAAGAATTGCAATTGCTCGAGCGATGTTCAACAAGCTTTGGACTCGGCATTGGACTCGGCATGTTCAGGACGAACACATGTATTGTAATCGCCCATCGCCAGTGGAGCAGGGATCTCACTCCCAAACTCCCAACTTCTGGCCAAGAATGGGGCATTTATTCCAAGCTCTATCGCTTCGCTGTCAGACGAAAGCCTCTTGAATTTTTCTAGTACCACAATGAGGCA

Full Affymetrix probeset data:

Annotations for 1632500_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720