FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632503_at:

>probe:Drosophila_2:1632503_at:653:541; Interrogation_Position=1112; Antisense; GGTTGCAACAACTTCTCGACAATGT
>probe:Drosophila_2:1632503_at:426:591; Interrogation_Position=627; Antisense; TGGTCTTGTTCTTCAACGGGCGCAA
>probe:Drosophila_2:1632503_at:312:267; Interrogation_Position=656; Antisense; CAGTCGGGACTCTTTCTAGTGGGAT
>probe:Drosophila_2:1632503_at:336:25; Interrogation_Position=679; Antisense; ATATGTCGTGCTGATGTATGTTCTC
>probe:Drosophila_2:1632503_at:335:659; Interrogation_Position=714; Antisense; TAACGCCCATGTCGGTGCTGTTCAC
>probe:Drosophila_2:1632503_at:367:593; Interrogation_Position=771; Antisense; TGGGCAAGCTGTCTCAGGCGTATAC
>probe:Drosophila_2:1632503_at:420:575; Interrogation_Position=787; Antisense; GGCGTATACCAACTACCAGGCTGGA
>probe:Drosophila_2:1632503_at:317:589; Interrogation_Position=808; Antisense; TGGATCCACTGGTCAGTTGTCAGCC
>probe:Drosophila_2:1632503_at:167:321; Interrogation_Position=830; Antisense; GCCGCCACTGTGATCATGATGTTTG
>probe:Drosophila_2:1632503_at:477:59; Interrogation_Position=848; Antisense; ATGTTTGCAGGATCGGTGGCCCGCA
>probe:Drosophila_2:1632503_at:501:403; Interrogation_Position=899; Antisense; GACTTTATGATCATCCTCACTTTCA
>probe:Drosophila_2:1632503_at:574:249; Interrogation_Position=940; Antisense; CAATTCGGTTATTCTGGGCCAGCTG
>probe:Drosophila_2:1632503_at:584:643; Interrogation_Position=966; Antisense; TCTACTACTGGAACAAACCCGCTGG
>probe:Drosophila_2:1632503_at:337:201; Interrogation_Position=981; Antisense; AACCCGCTGGCGTCAAGGTGAAGGA

Paste this into a BLAST search page for me
GGTTGCAACAACTTCTCGACAATGTTGGTCTTGTTCTTCAACGGGCGCAACAGTCGGGACTCTTTCTAGTGGGATATATGTCGTGCTGATGTATGTTCTCTAACGCCCATGTCGGTGCTGTTCACTGGGCAAGCTGTCTCAGGCGTATACGGCGTATACCAACTACCAGGCTGGATGGATCCACTGGTCAGTTGTCAGCCGCCGCCACTGTGATCATGATGTTTGATGTTTGCAGGATCGGTGGCCCGCAGACTTTATGATCATCCTCACTTTCACAATTCGGTTATTCTGGGCCAGCTGTCTACTACTGGAACAAACCCGCTGGAACCCGCTGGCGTCAAGGTGAAGGA

Full Affymetrix probeset data:

Annotations for 1632503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720