Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632504_at:

>probe:Drosophila_2:1632504_at:114:455; Interrogation_Position=1059; Antisense; GATCACATCCAATATACTACTCGGT
>probe:Drosophila_2:1632504_at:231:251; Interrogation_Position=1107; Antisense; CAAGTGGTCGATCCGTCTGGGACTT
>probe:Drosophila_2:1632504_at:588:449; Interrogation_Position=1116; Antisense; GATCCGTCTGGGACTTTTACTATTG
>probe:Drosophila_2:1632504_at:403:527; Interrogation_Position=1125; Antisense; GGGACTTTTACTATTGTTCTTGCAA
>probe:Drosophila_2:1632504_at:259:645; Interrogation_Position=1142; Antisense; TCTTGCAAATGCTTTTCTTCGGCTT
>probe:Drosophila_2:1632504_at:697:355; Interrogation_Position=1146; Antisense; GCAAATGCTTTTCTTCGGCTTTGGA
>probe:Drosophila_2:1632504_at:67:269; Interrogation_Position=1366; Antisense; CAGGATGATTCGGAGACTGATCTTA
>probe:Drosophila_2:1632504_at:187:405; Interrogation_Position=1380; Antisense; GACTGATCTTAAGGTCAATTCTCCA
>probe:Drosophila_2:1632504_at:231:537; Interrogation_Position=1392; Antisense; GGTCAATTCTCCAATTTCAATGCCC
>probe:Drosophila_2:1632504_at:556:291; Interrogation_Position=1419; Antisense; CGTCATAAGTGCCATCAGTGTTTTT
>probe:Drosophila_2:1632504_at:569:269; Interrogation_Position=1431; Antisense; CATCAGTGTTTTTGTGGCCATCGTC
>probe:Drosophila_2:1632504_at:359:315; Interrogation_Position=1447; Antisense; GCCATCGTCTTGAGCAGTTTCATTA
>probe:Drosophila_2:1632504_at:476:375; Interrogation_Position=1492; Antisense; GAAGAAACTAGAGTCGCCAACGAAA
>probe:Drosophila_2:1632504_at:179:431; Interrogation_Position=1502; Antisense; GAGTCGCCAACGAAAACATTCCTTA

Paste this into a BLAST search page for me
GATCACATCCAATATACTACTCGGTCAAGTGGTCGATCCGTCTGGGACTTGATCCGTCTGGGACTTTTACTATTGGGGACTTTTACTATTGTTCTTGCAATCTTGCAAATGCTTTTCTTCGGCTTGCAAATGCTTTTCTTCGGCTTTGGACAGGATGATTCGGAGACTGATCTTAGACTGATCTTAAGGTCAATTCTCCAGGTCAATTCTCCAATTTCAATGCCCCGTCATAAGTGCCATCAGTGTTTTTCATCAGTGTTTTTGTGGCCATCGTCGCCATCGTCTTGAGCAGTTTCATTAGAAGAAACTAGAGTCGCCAACGAAAGAGTCGCCAACGAAAACATTCCTTA

Full Affymetrix probeset data:

Annotations for 1632504_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime