FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632509_at:

>probe:Drosophila_2:1632509_at:576:207; Interrogation_Position=1235; Antisense; AAGCTGATCCTGGAAGGCGCCAACG
>probe:Drosophila_2:1632509_at:122:589; Interrogation_Position=1293; Antisense; TGGATAAGGGTGTCCTCCTAGTTCC
>probe:Drosophila_2:1632509_at:728:673; Interrogation_Position=1311; Antisense; TAGTTCCCGATCTCTATTGCAATGC
>probe:Drosophila_2:1632509_at:373:51; Interrogation_Position=1332; Antisense; ATGCGGGCGGCGTAACAGTATCCTA
>probe:Drosophila_2:1632509_at:353:193; Interrogation_Position=1403; Antisense; AACTCTAAATCTACATCCGAGCTTA
>probe:Drosophila_2:1632509_at:327:431; Interrogation_Position=1454; Antisense; GAGTCTTTGCATGAATGCCCCGATA
>probe:Drosophila_2:1632509_at:463:89; Interrogation_Position=1478; Antisense; AGTCAACTACCGAACATATGTCCCA
>probe:Drosophila_2:1632509_at:434:231; Interrogation_Position=1527; Antisense; AATGCACCACAGAGGCGGATATCGT
>probe:Drosophila_2:1632509_at:23:405; Interrogation_Position=1553; Antisense; GACTCGGCTCTCCAAACAGTTATGG
>probe:Drosophila_2:1632509_at:382:585; Interrogation_Position=1575; Antisense; TGGAATCTGCAGCACGTGGCATCAA
>probe:Drosophila_2:1632509_at:613:3; Interrogation_Position=1621; Antisense; ATTGTGTAACGATCTGCGGAGGGCC
>probe:Drosophila_2:1632509_at:623:299; Interrogation_Position=1645; Antisense; CGCCTACGTTTGGTCTTCATTCAAA
>probe:Drosophila_2:1632509_at:140:393; Interrogation_Position=1685; Antisense; GAAAGCTCCGGAATTTCCCAACAGT
>probe:Drosophila_2:1632509_at:519:631; Interrogation_Position=1700; Antisense; TCCCAACAGTAGTGGTTTACCCTCA

Paste this into a BLAST search page for me
AAGCTGATCCTGGAAGGCGCCAACGTGGATAAGGGTGTCCTCCTAGTTCCTAGTTCCCGATCTCTATTGCAATGCATGCGGGCGGCGTAACAGTATCCTAAACTCTAAATCTACATCCGAGCTTAGAGTCTTTGCATGAATGCCCCGATAAGTCAACTACCGAACATATGTCCCAAATGCACCACAGAGGCGGATATCGTGACTCGGCTCTCCAAACAGTTATGGTGGAATCTGCAGCACGTGGCATCAAATTGTGTAACGATCTGCGGAGGGCCCGCCTACGTTTGGTCTTCATTCAAAGAAAGCTCCGGAATTTCCCAACAGTTCCCAACAGTAGTGGTTTACCCTCA

Full Affymetrix probeset data:

Annotations for 1632509_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720