FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632510_at:

>probe:Drosophila_2:1632510_at:73:561; Interrogation_Position=1590; Antisense; GGAAACTGGTCGTCGGATCTTCAAA
>probe:Drosophila_2:1632510_at:132:453; Interrogation_Position=1605; Antisense; GATCTTCAAATCGTACGACCCGGAG
>probe:Drosophila_2:1632510_at:142:435; Interrogation_Position=1627; Antisense; GAGGGCAACAATTTCATATCGACCA
>probe:Drosophila_2:1632510_at:616:161; Interrogation_Position=1651; Antisense; ACAATGCTGCGCGAAGTTCTCATCG
>probe:Drosophila_2:1632510_at:114:713; Interrogation_Position=1667; Antisense; TTCTCATCGCCTTGAATCTGGTCAG
>probe:Drosophila_2:1632510_at:193:109; Interrogation_Position=1718; Antisense; AGAAGCGTCTTGATCCGGAGAACTT
>probe:Drosophila_2:1632510_at:380:51; Interrogation_Position=1760; Antisense; ATGCGTTCATGGACGAGTTCTTCCC
>probe:Drosophila_2:1632510_at:428:455; Interrogation_Position=1807; Antisense; GATACGTTCGAGCTGATGCACTACA
>probe:Drosophila_2:1632510_at:356:569; Interrogation_Position=1834; Antisense; GGCATACCGGGCTCCAATGAGAACA
>probe:Drosophila_2:1632510_at:70:187; Interrogation_Position=1858; Antisense; AACAAGGTGCGCTACTATTGCGGCA
>probe:Drosophila_2:1632510_at:344:723; Interrogation_Position=1875; Antisense; TTGCGGCACGGCCATTTTGCTGGAA
>probe:Drosophila_2:1632510_at:394:39; Interrogation_Position=1904; Antisense; ATCTGAAGTCGGTCTGCACCTCGAA
>probe:Drosophila_2:1632510_at:633:21; Interrogation_Position=1991; Antisense; ATATGCCCTCCTTGAATTGACGCCG
>probe:Drosophila_2:1632510_at:72:711; Interrogation_Position=2007; Antisense; TTGACGCCGTCAAGGGATCCACAGA

Paste this into a BLAST search page for me
GGAAACTGGTCGTCGGATCTTCAAAGATCTTCAAATCGTACGACCCGGAGGAGGGCAACAATTTCATATCGACCAACAATGCTGCGCGAAGTTCTCATCGTTCTCATCGCCTTGAATCTGGTCAGAGAAGCGTCTTGATCCGGAGAACTTATGCGTTCATGGACGAGTTCTTCCCGATACGTTCGAGCTGATGCACTACAGGCATACCGGGCTCCAATGAGAACAAACAAGGTGCGCTACTATTGCGGCATTGCGGCACGGCCATTTTGCTGGAAATCTGAAGTCGGTCTGCACCTCGAAATATGCCCTCCTTGAATTGACGCCGTTGACGCCGTCAAGGGATCCACAGA

Full Affymetrix probeset data:

Annotations for 1632510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720