Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632512_at:

>probe:Drosophila_2:1632512_at:443:437; Interrogation_Position=273; Antisense; GAGGAGAAGTTCTGGTCGCACCGCA
>probe:Drosophila_2:1632512_at:236:383; Interrogation_Position=317; Antisense; GAACGAGTCCTACCATGGCTACAAG
>probe:Drosophila_2:1632512_at:515:685; Interrogation_Position=364; Antisense; TATACCACAAGTGCTCGCTGTACTG
>probe:Drosophila_2:1632512_at:597:491; Interrogation_Position=390; Antisense; GTAAACAAGTTCAACAGCTCGCCGC
>probe:Drosophila_2:1632512_at:234:125; Interrogation_Position=421; Antisense; AGCCCAGCCATAGGTATCTCAAGCG
>probe:Drosophila_2:1632512_at:642:463; Interrogation_Position=454; Antisense; GATTGCTGCGGAAGTATCCACTGGA
>probe:Drosophila_2:1632512_at:193:523; Interrogation_Position=506; Antisense; GGGCTGCAAGGCGTTTTACTTCTAT
>probe:Drosophila_2:1632512_at:599:705; Interrogation_Position=521; Antisense; TTACTTCTATAACTCGACCACACAG
>probe:Drosophila_2:1632512_at:141:159; Interrogation_Position=540; Antisense; ACACAGACTGTTTCGTGGCTACCTC
>probe:Drosophila_2:1632512_at:270:85; Interrogation_Position=602; Antisense; AGTGTTTCGCAGACAACTGGCCAAC
>probe:Drosophila_2:1632512_at:276:429; Interrogation_Position=636; Antisense; GAGTTCAACTTCGATACCAACATGG
>probe:Drosophila_2:1632512_at:201:711; Interrogation_Position=661; Antisense; TTCAGCCCAAGTCTTCTAACCAAAA
>probe:Drosophila_2:1632512_at:424:11; Interrogation_Position=707; Antisense; ATTCGTTCCCGCCAAGAAGCAAAAG
>probe:Drosophila_2:1632512_at:201:165; Interrogation_Position=751; Antisense; AAATCCAACGACGTCGCCGTAATGA

Paste this into a BLAST search page for me
GAGGAGAAGTTCTGGTCGCACCGCAGAACGAGTCCTACCATGGCTACAAGTATACCACAAGTGCTCGCTGTACTGGTAAACAAGTTCAACAGCTCGCCGCAGCCCAGCCATAGGTATCTCAAGCGGATTGCTGCGGAAGTATCCACTGGAGGGCTGCAAGGCGTTTTACTTCTATTTACTTCTATAACTCGACCACACAGACACAGACTGTTTCGTGGCTACCTCAGTGTTTCGCAGACAACTGGCCAACGAGTTCAACTTCGATACCAACATGGTTCAGCCCAAGTCTTCTAACCAAAAATTCGTTCCCGCCAAGAAGCAAAAGAAATCCAACGACGTCGCCGTAATGA

Full Affymetrix probeset data:

Annotations for 1632512_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime