Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632513_at:

>probe:Drosophila_2:1632513_at:527:567; Interrogation_Position=1006; Antisense; GGCAGTAACCGATGTCACCAGCGAG
>probe:Drosophila_2:1632513_at:410:483; Interrogation_Position=1036; Antisense; GTATCCCACTTTCGAGGCAGTCAAG
>probe:Drosophila_2:1632513_at:611:227; Interrogation_Position=1075; Antisense; AATGGAGCTACTTGCTGACGATCGA
>probe:Drosophila_2:1632513_at:340:283; Interrogation_Position=1089; Antisense; CTGACGATCGAGTGTTGGCGGCCCT
>probe:Drosophila_2:1632513_at:24:583; Interrogation_Position=1104; Antisense; TGGCGGCCCTGGAAAGTGTTTACAA
>probe:Drosophila_2:1632513_at:576:477; Interrogation_Position=1121; Antisense; GTTTACAACTCGGATCTCAGACAGA
>probe:Drosophila_2:1632513_at:136:693; Interrogation_Position=652; Antisense; TTTGTATGGCGTACCCGCTGAGCAT
>probe:Drosophila_2:1632513_at:293:609; Interrogation_Position=670; Antisense; TGAGCATCGCAACATGCCGCTGGAG
>probe:Drosophila_2:1632513_at:660:451; Interrogation_Position=709; Antisense; GATCTCCACCGATTTTAGGCTCAAA
>probe:Drosophila_2:1632513_at:63:271; Interrogation_Position=772; Antisense; CATACACAAGGGACAGCGACGACAT
>probe:Drosophila_2:1632513_at:51:107; Interrogation_Position=832; Antisense; AGACAATCATCCATTGACCGCGTCG
>probe:Drosophila_2:1632513_at:142:411; Interrogation_Position=847; Antisense; GACCGCGTCGCAGTACGAGGTGATT
>probe:Drosophila_2:1632513_at:651:509; Interrogation_Position=866; Antisense; GTGATTCTTAAGTACCTCGAAGGCG
>probe:Drosophila_2:1632513_at:597:207; Interrogation_Position=941; Antisense; AAGCTAAAAGCTCCCGATCCAGAGA

Paste this into a BLAST search page for me
GGCAGTAACCGATGTCACCAGCGAGGTATCCCACTTTCGAGGCAGTCAAGAATGGAGCTACTTGCTGACGATCGACTGACGATCGAGTGTTGGCGGCCCTTGGCGGCCCTGGAAAGTGTTTACAAGTTTACAACTCGGATCTCAGACAGATTTGTATGGCGTACCCGCTGAGCATTGAGCATCGCAACATGCCGCTGGAGGATCTCCACCGATTTTAGGCTCAAACATACACAAGGGACAGCGACGACATAGACAATCATCCATTGACCGCGTCGGACCGCGTCGCAGTACGAGGTGATTGTGATTCTTAAGTACCTCGAAGGCGAAGCTAAAAGCTCCCGATCCAGAGA

Full Affymetrix probeset data:

Annotations for 1632513_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime