Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632515_a_at:

>probe:Drosophila_2:1632515_a_at:326:391; Interrogation_Position=190; Antisense; GAAAGACGTCTACTGAAAAATTGGA
>probe:Drosophila_2:1632515_a_at:25:393; Interrogation_Position=218; Antisense; GAAAGCCAAACTAGAACGCAGCAGA
>probe:Drosophila_2:1632515_a_at:675:199; Interrogation_Position=232; Antisense; AACGCAGCAGACAAAGTGCCAGGGA
>probe:Drosophila_2:1632515_a_at:350:253; Interrogation_Position=269; Antisense; CAAGAAGCTGCGGTATCAGTACCTG
>probe:Drosophila_2:1632515_a_at:100:109; Interrogation_Position=316; Antisense; AGAAGGCTGTAGTTGCTTTGCGTAC
>probe:Drosophila_2:1632515_a_at:260:469; Interrogation_Position=327; Antisense; GTTGCTTTGCGTACGGAACTGGAGC
>probe:Drosophila_2:1632515_a_at:386:65; Interrogation_Position=362; Antisense; ATGGAATAACCAGTTGAGCGAAAGC
>probe:Drosophila_2:1632515_a_at:337:609; Interrogation_Position=376; Antisense; TGAGCGAAAGCAACACTCCAACCAA
>probe:Drosophila_2:1632515_a_at:60:157; Interrogation_Position=388; Antisense; ACACTCCAACCAACAATGACCAGTT
>probe:Drosophila_2:1632515_a_at:250:31; Interrogation_Position=403; Antisense; ATGACCAGTTACTTCAGGAACTCGG
>probe:Drosophila_2:1632515_a_at:678:559; Interrogation_Position=419; Antisense; GGAACTCGGAATCCTCAAACAAGAA
>probe:Drosophila_2:1632515_a_at:72:659; Interrogation_Position=444; Antisense; TAACCTACATTCTTATTTTTAGCTT
>probe:Drosophila_2:1632515_a_at:395:37; Interrogation_Position=491; Antisense; ATGTACGACGGTTACTATTTATATT
>probe:Drosophila_2:1632515_a_at:632:343; Interrogation_Position=557; Antisense; GCATTTTACAGCTTTTTATTGTTTC

Paste this into a BLAST search page for me
GAAAGACGTCTACTGAAAAATTGGAGAAAGCCAAACTAGAACGCAGCAGAAACGCAGCAGACAAAGTGCCAGGGACAAGAAGCTGCGGTATCAGTACCTGAGAAGGCTGTAGTTGCTTTGCGTACGTTGCTTTGCGTACGGAACTGGAGCATGGAATAACCAGTTGAGCGAAAGCTGAGCGAAAGCAACACTCCAACCAAACACTCCAACCAACAATGACCAGTTATGACCAGTTACTTCAGGAACTCGGGGAACTCGGAATCCTCAAACAAGAATAACCTACATTCTTATTTTTAGCTTATGTACGACGGTTACTATTTATATTGCATTTTACAGCTTTTTATTGTTTC

Full Affymetrix probeset data:

Annotations for 1632515_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime