Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632516_at:

>probe:Drosophila_2:1632516_at:566:551; Interrogation_Position=1251; Antisense; GGAGCAAGCGCATTCTAGCCATATT
>probe:Drosophila_2:1632516_at:524:689; Interrogation_Position=1272; Antisense; TATTTTGTGAACCAGGCAGCCGGGA
>probe:Drosophila_2:1632516_at:333:371; Interrogation_Position=1309; Antisense; GAAGGCCATTCGGTTGGGCTGCATC
>probe:Drosophila_2:1632516_at:87:101; Interrogation_Position=1375; Antisense; AGAGGAATCGCACATACGCCAGATG
>probe:Drosophila_2:1632516_at:720:585; Interrogation_Position=1416; Antisense; TGGAAACGGAGCAGCGTATCCTCAC
>probe:Drosophila_2:1632516_at:454:261; Interrogation_Position=1438; Antisense; CACCGAACAGCGCATGGCCATGGAA
>probe:Drosophila_2:1632516_at:553:33; Interrogation_Position=1495; Antisense; ATCCAACGTTGGAGTTCCTGGTCCG
>probe:Drosophila_2:1632516_at:240:391; Interrogation_Position=1520; Antisense; GAAAGCGGATCCTTTGCCCAAGGGT
>probe:Drosophila_2:1632516_at:213:223; Interrogation_Position=1539; Antisense; AAGGGTCTGATCTTCAATCTCTGAA
>probe:Drosophila_2:1632516_at:506:613; Interrogation_Position=1560; Antisense; TGAACAACTGGTCAGCACCGCAGGC
>probe:Drosophila_2:1632516_at:515:657; Interrogation_Position=1636; Antisense; TAAGGGCTACATCAAACAGGCTCGC
>probe:Drosophila_2:1632516_at:455:69; Interrogation_Position=1653; Antisense; AGGCTCGCCAGGACATGAACTTTGA
>probe:Drosophila_2:1632516_at:166:131; Interrogation_Position=1688; Antisense; ACGCTGGAGCTAAATCTTCGCGAGC
>probe:Drosophila_2:1632516_at:16:439; Interrogation_Position=1775; Antisense; GAGGCCTAAGCAGTATCCTACATAG

Paste this into a BLAST search page for me
GGAGCAAGCGCATTCTAGCCATATTTATTTTGTGAACCAGGCAGCCGGGAGAAGGCCATTCGGTTGGGCTGCATCAGAGGAATCGCACATACGCCAGATGTGGAAACGGAGCAGCGTATCCTCACCACCGAACAGCGCATGGCCATGGAAATCCAACGTTGGAGTTCCTGGTCCGGAAAGCGGATCCTTTGCCCAAGGGTAAGGGTCTGATCTTCAATCTCTGAATGAACAACTGGTCAGCACCGCAGGCTAAGGGCTACATCAAACAGGCTCGCAGGCTCGCCAGGACATGAACTTTGAACGCTGGAGCTAAATCTTCGCGAGCGAGGCCTAAGCAGTATCCTACATAG

Full Affymetrix probeset data:

Annotations for 1632516_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime