Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632517_at:

>probe:Drosophila_2:1632517_at:412:273; Interrogation_Position=1019; Antisense; CATTATCATCTCTTTGGACGACCGA
>probe:Drosophila_2:1632517_at:303:653; Interrogation_Position=1054; Antisense; TCAACTGTTGGCGACATGGCGATGT
>probe:Drosophila_2:1632517_at:287:681; Interrogation_Position=1086; Antisense; TATGATATCACCGATCCCGAGAATC
>probe:Drosophila_2:1632517_at:329:649; Interrogation_Position=1124; Antisense; TCAGCTTTTCCTTGGCGGTGCGATA
>probe:Drosophila_2:1632517_at:702:423; Interrogation_Position=1199; Antisense; GAGACCTCCAGCTCGTTACGTGAAG
>probe:Drosophila_2:1632517_at:678:371; Interrogation_Position=1236; Antisense; GAAGGAGGTCCCCAAATGCTGCAGC
>probe:Drosophila_2:1632517_at:164:585; Interrogation_Position=1271; Antisense; TGGCAAGCGCTTGTATGTCTCCTCA
>probe:Drosophila_2:1632517_at:594:647; Interrogation_Position=1293; Antisense; TCATCTCTGTATTCGCCATGGGATA
>probe:Drosophila_2:1632517_at:10:525; Interrogation_Position=1346; Antisense; GGGCGGTCATATTGTCCTGATTGAT
>probe:Drosophila_2:1632517_at:581:431; Interrogation_Position=1404; Antisense; GAGGACTTTTTGGTGGACTTCGCCA
>probe:Drosophila_2:1632517_at:104:53; Interrogation_Position=1429; Antisense; ATGAACCCTATGGTCCTAGTTTGCC
>probe:Drosophila_2:1632517_at:40:675; Interrogation_Position=1445; Antisense; TAGTTTGCCCCACGAAATGCGTTAT
>probe:Drosophila_2:1632517_at:665:231; Interrogation_Position=1460; Antisense; AATGCGTTATCCTGGCGGTGATTGC
>probe:Drosophila_2:1632517_at:294:357; Interrogation_Position=1483; Antisense; GCACATCGGACATTTGGCTGGCTAA

Paste this into a BLAST search page for me
CATTATCATCTCTTTGGACGACCGATCAACTGTTGGCGACATGGCGATGTTATGATATCACCGATCCCGAGAATCTCAGCTTTTCCTTGGCGGTGCGATAGAGACCTCCAGCTCGTTACGTGAAGGAAGGAGGTCCCCAAATGCTGCAGCTGGCAAGCGCTTGTATGTCTCCTCATCATCTCTGTATTCGCCATGGGATAGGGCGGTCATATTGTCCTGATTGATGAGGACTTTTTGGTGGACTTCGCCAATGAACCCTATGGTCCTAGTTTGCCTAGTTTGCCCCACGAAATGCGTTATAATGCGTTATCCTGGCGGTGATTGCGCACATCGGACATTTGGCTGGCTAA

Full Affymetrix probeset data:

Annotations for 1632517_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime