FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632518_at:

>probe:Drosophila_2:1632518_at:155:435; Interrogation_Position=113; Antisense; GAGGTGCCAAAGGTTCATCTTCTAT
>probe:Drosophila_2:1632518_at:594:645; Interrogation_Position=127; Antisense; TCATCTTCTATGGAGGCGCGAGCAA
>probe:Drosophila_2:1632518_at:429:577; Interrogation_Position=141; Antisense; GGCGCGAGCAATGGCAACAACTTCA
>probe:Drosophila_2:1632518_at:380:157; Interrogation_Position=157; Antisense; ACAACTTCAATACCCAAGCTCGATG
>probe:Drosophila_2:1632518_at:588:27; Interrogation_Position=166; Antisense; ATACCCAAGCTCGATGTCACAAAAT
>probe:Drosophila_2:1632518_at:209:495; Interrogation_Position=181; Antisense; GTCACAAAATTTGCCTAGCCCAAGT
>probe:Drosophila_2:1632518_at:182:675; Interrogation_Position=196; Antisense; TAGCCCAAGTCTCTTTGCCAATTAA
>probe:Drosophila_2:1632518_at:304:309; Interrogation_Position=212; Antisense; GCCAATTAATTTCAACTCCACTGCC
>probe:Drosophila_2:1632518_at:435:145; Interrogation_Position=226; Antisense; ACTCCACTGCCGCTTAAAAAGAACA
>probe:Drosophila_2:1632518_at:300:461; Interrogation_Position=23; Antisense; GATTTTAGTCAAACGCAGATGCCTT
>probe:Drosophila_2:1632518_at:434:315; Interrogation_Position=43; Antisense; GCCTTCAGCCACTGGATGTGGGCAA
>probe:Drosophila_2:1632518_at:204:579; Interrogation_Position=74; Antisense; GGCCTATCTGCGCAATTGGTTCTAC
>probe:Drosophila_2:1632518_at:561:247; Interrogation_Position=87; Antisense; AATTGGTTCTACAACTCCACATCGC
>probe:Drosophila_2:1632518_at:266:193; Interrogation_Position=99; Antisense; AACTCCACATCGCAGAGGTGCCAAA

Paste this into a BLAST search page for me
GAGGTGCCAAAGGTTCATCTTCTATTCATCTTCTATGGAGGCGCGAGCAAGGCGCGAGCAATGGCAACAACTTCAACAACTTCAATACCCAAGCTCGATGATACCCAAGCTCGATGTCACAAAATGTCACAAAATTTGCCTAGCCCAAGTTAGCCCAAGTCTCTTTGCCAATTAAGCCAATTAATTTCAACTCCACTGCCACTCCACTGCCGCTTAAAAAGAACAGATTTTAGTCAAACGCAGATGCCTTGCCTTCAGCCACTGGATGTGGGCAAGGCCTATCTGCGCAATTGGTTCTACAATTGGTTCTACAACTCCACATCGCAACTCCACATCGCAGAGGTGCCAAA

Full Affymetrix probeset data:

Annotations for 1632518_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720