FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632519_at:

>probe:Drosophila_2:1632519_at:168:553; Interrogation_Position=1027; Antisense; GGAGCACAAGCGCTTCATATTGAAA
>probe:Drosophila_2:1632519_at:639:233; Interrogation_Position=1086; Antisense; AATGCGGTCTGATCCTGCACGAGAA
>probe:Drosophila_2:1632519_at:532:67; Interrogation_Position=1137; Antisense; ATGGCATCACGGACGATCACATTGT
>probe:Drosophila_2:1632519_at:248:423; Interrogation_Position=1196; Antisense; GAGAAGTACCTCGAGGCACGCGAAT
>probe:Drosophila_2:1632519_at:180:135; Interrogation_Position=1213; Antisense; ACGCGAATCTATTGCACCCAAGTAC
>probe:Drosophila_2:1632519_at:335:165; Interrogation_Position=1251; Antisense; AAATCCAGATGTTTGCGGCGAATGT
>probe:Drosophila_2:1632519_at:442:227; Interrogation_Position=1280; Antisense; AAGGCGCTCTACTGCGTGCTAAGTC
>probe:Drosophila_2:1632519_at:52:659; Interrogation_Position=1299; Antisense; TAAGTCCCACGTTCGAGAGCAACGG
>probe:Drosophila_2:1632519_at:111:553; Interrogation_Position=1322; Antisense; GGAGCACTACACTACGTTTGGGTAC
>probe:Drosophila_2:1632519_at:730:329; Interrogation_Position=1349; Antisense; GCGGATCCGGAATTCGTTAGCAGTT
>probe:Drosophila_2:1632519_at:387:279; Interrogation_Position=1386; Antisense; CTGAAGACTTCTGGCGGGACGTTGT
>probe:Drosophila_2:1632519_at:129:539; Interrogation_Position=889; Antisense; GGTACAGTATATGCGCATCCGTTGC
>probe:Drosophila_2:1632519_at:268:47; Interrogation_Position=905; Antisense; ATCCGTTGCTCCATGATGCACATGA
>probe:Drosophila_2:1632519_at:682:31; Interrogation_Position=932; Antisense; ATAAGCCGCAAAACCTCTGATGATG

Paste this into a BLAST search page for me
GGAGCACAAGCGCTTCATATTGAAAAATGCGGTCTGATCCTGCACGAGAAATGGCATCACGGACGATCACATTGTGAGAAGTACCTCGAGGCACGCGAATACGCGAATCTATTGCACCCAAGTACAAATCCAGATGTTTGCGGCGAATGTAAGGCGCTCTACTGCGTGCTAAGTCTAAGTCCCACGTTCGAGAGCAACGGGGAGCACTACACTACGTTTGGGTACGCGGATCCGGAATTCGTTAGCAGTTCTGAAGACTTCTGGCGGGACGTTGTGGTACAGTATATGCGCATCCGTTGCATCCGTTGCTCCATGATGCACATGAATAAGCCGCAAAACCTCTGATGATG

Full Affymetrix probeset data:

Annotations for 1632519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720