FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632521_at:

>probe:Drosophila_2:1632521_at:516:185; Interrogation_Position=1061; Antisense; AACAAAGTCCGCTGGTCTTCCTGCG
>probe:Drosophila_2:1632521_at:528:645; Interrogation_Position=1118; Antisense; TCTTCGGCTGGCATGTGCACGAGAA
>probe:Drosophila_2:1632521_at:253:371; Interrogation_Position=1140; Antisense; GAAGGCCATCTTAATGGTGCTCCTT
>probe:Drosophila_2:1632521_at:208:497; Interrogation_Position=1172; Antisense; GTCTGCTCACGCTGGTAAACCGGGA
>probe:Drosophila_2:1632521_at:75:203; Interrogation_Position=1189; Antisense; AACCGGGAGGATGCCAGATACGCCT
>probe:Drosophila_2:1632521_at:606:95; Interrogation_Position=1204; Antisense; AGATACGCCTATGTCCTTGGCATTG
>probe:Drosophila_2:1632521_at:484:51; Interrogation_Position=1262; Antisense; ATGCGGATCTGTACATTCCCCGGTA
>probe:Drosophila_2:1632521_at:217:539; Interrogation_Position=1283; Antisense; GGTATTCCCTGTACATGTCGTACGT
>probe:Drosophila_2:1632521_at:337:57; Interrogation_Position=1312; Antisense; ATGATGTACGGCCAGCTGTATCGCA
>probe:Drosophila_2:1632521_at:465:83; Interrogation_Position=1370; Antisense; AGTGGCTATACATGCTGGGCTTCAT
>probe:Drosophila_2:1632521_at:620:67; Interrogation_Position=1393; Antisense; ATGGCTATTCCGCTGTACGAGCATC
>probe:Drosophila_2:1632521_at:121:489; Interrogation_Position=1482; Antisense; GTACTCGGCGTTGGGAGTGCTCTAC
>probe:Drosophila_2:1632521_at:82:39; Interrogation_Position=1523; Antisense; ATCTGTACGCTCTGGGCATTAGCTG
>probe:Drosophila_2:1632521_at:640:45; Interrogation_Position=1575; Antisense; ATCCGCGGCCGCTGTTAAGAGAAAA

Paste this into a BLAST search page for me
AACAAAGTCCGCTGGTCTTCCTGCGTCTTCGGCTGGCATGTGCACGAGAAGAAGGCCATCTTAATGGTGCTCCTTGTCTGCTCACGCTGGTAAACCGGGAAACCGGGAGGATGCCAGATACGCCTAGATACGCCTATGTCCTTGGCATTGATGCGGATCTGTACATTCCCCGGTAGGTATTCCCTGTACATGTCGTACGTATGATGTACGGCCAGCTGTATCGCAAGTGGCTATACATGCTGGGCTTCATATGGCTATTCCGCTGTACGAGCATCGTACTCGGCGTTGGGAGTGCTCTACATCTGTACGCTCTGGGCATTAGCTGATCCGCGGCCGCTGTTAAGAGAAAA

Full Affymetrix probeset data:

Annotations for 1632521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720