Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632523_at:

>probe:Drosophila_2:1632523_at:362:505; Interrogation_Position=2778; Antisense; GTGCTCGGAGGTAGATCAGTTGCCC
>probe:Drosophila_2:1632523_at:388:123; Interrogation_Position=2855; Antisense; AGCGAGCTGAGCTGCTTCTGAGTCC
>probe:Drosophila_2:1632523_at:594:639; Interrogation_Position=2871; Antisense; TCTGAGTCCCAGTCACAGGCAGATG
>probe:Drosophila_2:1632523_at:246:99; Interrogation_Position=2891; Antisense; AGATGACTCCTTGTGGCTTGGATTC
>probe:Drosophila_2:1632523_at:272:235; Interrogation_Position=2950; Antisense; AATACTGCGGATATAGCCGACCTAA
>probe:Drosophila_2:1632523_at:196:215; Interrogation_Position=2974; Antisense; AAGATCTTTTACCAAACCCACATCA
>probe:Drosophila_2:1632523_at:606:663; Interrogation_Position=3005; Antisense; TAAAGCGCGCGCATGAGGATCAGGT
>probe:Drosophila_2:1632523_at:679:507; Interrogation_Position=3028; Antisense; GTGCGCAAGCTGAGCGATCGGATAA
>probe:Drosophila_2:1632523_at:695:169; Interrogation_Position=3051; Antisense; AAAGTTCTATGAGCGACAGCAGGGT
>probe:Drosophila_2:1632523_at:476:443; Interrogation_Position=3076; Antisense; GATGATGACTATAAGCCTGCAACCG
>probe:Drosophila_2:1632523_at:278:241; Interrogation_Position=3151; Antisense; AATACCTCCCTTATTATCATCGATG
>probe:Drosophila_2:1632523_at:176:249; Interrogation_Position=3254; Antisense; AATTGGCCTTGGCTCGGCAGGACAT
>probe:Drosophila_2:1632523_at:601:73; Interrogation_Position=3272; Antisense; AGGACATCGCCACCGAGTTGGAGCA
>probe:Drosophila_2:1632523_at:106:249; Interrogation_Position=3341; Antisense; CAATTCATTGCACGGTTTCTGTTAA

Paste this into a BLAST search page for me
GTGCTCGGAGGTAGATCAGTTGCCCAGCGAGCTGAGCTGCTTCTGAGTCCTCTGAGTCCCAGTCACAGGCAGATGAGATGACTCCTTGTGGCTTGGATTCAATACTGCGGATATAGCCGACCTAAAAGATCTTTTACCAAACCCACATCATAAAGCGCGCGCATGAGGATCAGGTGTGCGCAAGCTGAGCGATCGGATAAAAAGTTCTATGAGCGACAGCAGGGTGATGATGACTATAAGCCTGCAACCGAATACCTCCCTTATTATCATCGATGAATTGGCCTTGGCTCGGCAGGACATAGGACATCGCCACCGAGTTGGAGCACAATTCATTGCACGGTTTCTGTTAA

Full Affymetrix probeset data:

Annotations for 1632523_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime