Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632524_at:

>probe:Drosophila_2:1632524_at:372:495; Interrogation_Position=2736; Antisense; GTCAGCTGATCTGCGACTACTGCCA
>probe:Drosophila_2:1632524_at:594:641; Interrogation_Position=2745; Antisense; TCTGCGACTACTGCCAGCGGCTGGA
>probe:Drosophila_2:1632524_at:361:627; Interrogation_Position=2798; Antisense; TGCCATCTCTCGCAGACTTTCTTTG
>probe:Drosophila_2:1632524_at:574:45; Interrogation_Position=2843; Antisense; ATCCCTCTACTGTGCTCTTTGAAAA
>probe:Drosophila_2:1632524_at:530:699; Interrogation_Position=2884; Antisense; TTTTTCTACCTTTATGGCTTGTAAT
>probe:Drosophila_2:1632524_at:203:691; Interrogation_Position=2912; Antisense; TTTCCATTCCTAACAAATATTACTG
>probe:Drosophila_2:1632524_at:97:383; Interrogation_Position=2953; Antisense; GAACGAATGCAGAACGATAGAGATC
>probe:Drosophila_2:1632524_at:231:425; Interrogation_Position=2972; Antisense; GAGATCGATCAGAAAGCTAAGGCTT
>probe:Drosophila_2:1632524_at:79:335; Interrogation_Position=2987; Antisense; GCTAAGGCTTAGCTAAAGGCCAAAC
>probe:Drosophila_2:1632524_at:375:661; Interrogation_Position=3000; Antisense; TAAAGGCCAAACTCACCAGCTCACA
>probe:Drosophila_2:1632524_at:421:619; Interrogation_Position=3047; Antisense; TGCATAGACACACACAGTCACACAG
>probe:Drosophila_2:1632524_at:675:123; Interrogation_Position=3081; Antisense; AGCGCATACATGCATCTATCTATTT
>probe:Drosophila_2:1632524_at:554:491; Interrogation_Position=3125; Antisense; GTAAACATTAGCTACCGTCGCAAAG
>probe:Drosophila_2:1632524_at:129:339; Interrogation_Position=3135; Antisense; GCTACCGTCGCAAAGAAAAAATCTC

Paste this into a BLAST search page for me
GTCAGCTGATCTGCGACTACTGCCATCTGCGACTACTGCCAGCGGCTGGATGCCATCTCTCGCAGACTTTCTTTGATCCCTCTACTGTGCTCTTTGAAAATTTTTCTACCTTTATGGCTTGTAATTTTCCATTCCTAACAAATATTACTGGAACGAATGCAGAACGATAGAGATCGAGATCGATCAGAAAGCTAAGGCTTGCTAAGGCTTAGCTAAAGGCCAAACTAAAGGCCAAACTCACCAGCTCACATGCATAGACACACACAGTCACACAGAGCGCATACATGCATCTATCTATTTGTAAACATTAGCTACCGTCGCAAAGGCTACCGTCGCAAAGAAAAAATCTC

Full Affymetrix probeset data:

Annotations for 1632524_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime