FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632525_at:

>probe:Drosophila_2:1632525_at:673:511; Interrogation_Position=2604; Antisense; GTGACCACAATGTTGTTCCGGGTTA
>probe:Drosophila_2:1632525_at:387:177; Interrogation_Position=2635; Antisense; AAACGTTGGTGAACTGTGCCTGGCG
>probe:Drosophila_2:1632525_at:698:505; Interrogation_Position=2650; Antisense; GTGCCTGGCGATCTACAGCGAAGAT
>probe:Drosophila_2:1632525_at:100:211; Interrogation_Position=2675; Antisense; AAGAACTGGTATCGCGGAGTCTGCC
>probe:Drosophila_2:1632525_at:348:391; Interrogation_Position=2776; Antisense; GAAACCGATTTCACAGGATTTGCTA
>probe:Drosophila_2:1632525_at:91:269; Interrogation_Position=2789; Antisense; CAGGATTTGCTAATTGCCGTCAATG
>probe:Drosophila_2:1632525_at:32:651; Interrogation_Position=2846; Antisense; TCAAAGAATTTTGCGGCTCTGGAGC
>probe:Drosophila_2:1632525_at:32:339; Interrogation_Position=2861; Antisense; GCTCTGGAGCAGTTTCTTGTGCGTA
>probe:Drosophila_2:1632525_at:710:95; Interrogation_Position=2886; Antisense; AGATTCGATTCTTATGCGGAGTTAA
>probe:Drosophila_2:1632525_at:336:27; Interrogation_Position=2928; Antisense; ATACTCGTCTCATTACAATTCCGGA
>probe:Drosophila_2:1632525_at:645:551; Interrogation_Position=2956; Antisense; GGAGACTATTCTAAACACACCAGTT
>probe:Drosophila_2:1632525_at:130:107; Interrogation_Position=2996; Antisense; AGAACTCGCATTCCTTCATATGACT
>probe:Drosophila_2:1632525_at:331:459; Interrogation_Position=3073; Antisense; GATATAAGTTTCGACCACAGTGTAT
>probe:Drosophila_2:1632525_at:181:709; Interrogation_Position=3127; Antisense; TTACATTTATTCCAGCACAGAGTGA

Paste this into a BLAST search page for me
GTGACCACAATGTTGTTCCGGGTTAAAACGTTGGTGAACTGTGCCTGGCGGTGCCTGGCGATCTACAGCGAAGATAAGAACTGGTATCGCGGAGTCTGCCGAAACCGATTTCACAGGATTTGCTACAGGATTTGCTAATTGCCGTCAATGTCAAAGAATTTTGCGGCTCTGGAGCGCTCTGGAGCAGTTTCTTGTGCGTAAGATTCGATTCTTATGCGGAGTTAAATACTCGTCTCATTACAATTCCGGAGGAGACTATTCTAAACACACCAGTTAGAACTCGCATTCCTTCATATGACTGATATAAGTTTCGACCACAGTGTATTTACATTTATTCCAGCACAGAGTGA

Full Affymetrix probeset data:

Annotations for 1632525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720