Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632527_at:

>probe:Drosophila_2:1632527_at:467:61; Interrogation_Position=1086; Antisense; ATGTCTCCGAGCTGTCCCCTGAATA
>probe:Drosophila_2:1632527_at:232:503; Interrogation_Position=1209; Antisense; GTCGCCGCCGTGATGTCTCTGAGCT
>probe:Drosophila_2:1632527_at:560:643; Interrogation_Position=1224; Antisense; TCTCTGAGCTGCCTTCCGGCGAGTA
>probe:Drosophila_2:1632527_at:210:77; Interrogation_Position=1263; Antisense; AGGAGACCGCCTCTGCCATCATTGA
>probe:Drosophila_2:1632527_at:717:271; Interrogation_Position=1279; Antisense; CATCATTGATGTGCCCGCCGAGCAG
>probe:Drosophila_2:1632527_at:626:295; Interrogation_Position=1297; Antisense; CGAGCAGACCGTCCTGGCCAGCGAT
>probe:Drosophila_2:1632527_at:705:635; Interrogation_Position=1345; Antisense; TCGTCTGAAGCTCCGTCGCCACTAA
>probe:Drosophila_2:1632527_at:642:299; Interrogation_Position=1389; Antisense; CCCACCGCAGCATTTGAGATTTTCG
>probe:Drosophila_2:1632527_at:709:427; Interrogation_Position=1404; Antisense; GAGATTTTCGAGGATGTTTTTCCAG
>probe:Drosophila_2:1632527_at:546:477; Interrogation_Position=1419; Antisense; GTTTTTCCAGAAGAAGTCCTGACTT
>probe:Drosophila_2:1632527_at:492:373; Interrogation_Position=1431; Antisense; GAAGTCCTGACTTTGACAGTCTCAG
>probe:Drosophila_2:1632527_at:528:399; Interrogation_Position=1445; Antisense; GACAGTCTCAGATTGAAACTAACAA
>probe:Drosophila_2:1632527_at:700:217; Interrogation_Position=1471; Antisense; AAGTCGAGCGTATTAGTCAATTTGA
>probe:Drosophila_2:1632527_at:15:369; Interrogation_Position=1494; Antisense; GAATCCACTATGAACAACCCGAGTA

Paste this into a BLAST search page for me
ATGTCTCCGAGCTGTCCCCTGAATAGTCGCCGCCGTGATGTCTCTGAGCTTCTCTGAGCTGCCTTCCGGCGAGTAAGGAGACCGCCTCTGCCATCATTGACATCATTGATGTGCCCGCCGAGCAGCGAGCAGACCGTCCTGGCCAGCGATTCGTCTGAAGCTCCGTCGCCACTAACCCACCGCAGCATTTGAGATTTTCGGAGATTTTCGAGGATGTTTTTCCAGGTTTTTCCAGAAGAAGTCCTGACTTGAAGTCCTGACTTTGACAGTCTCAGGACAGTCTCAGATTGAAACTAACAAAAGTCGAGCGTATTAGTCAATTTGAGAATCCACTATGAACAACCCGAGTA

Full Affymetrix probeset data:

Annotations for 1632527_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime