FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632531_at:

>probe:Drosophila_2:1632531_at:248:479; Interrogation_Position=318; Antisense; GTTTCAACACTCTGCAGTGCCTTTA
>probe:Drosophila_2:1632531_at:323:707; Interrogation_Position=340; Antisense; TTACCGCCTGCGACAGCAACAATGA
>probe:Drosophila_2:1632531_at:298:27; Interrogation_Position=364; Antisense; ATACCGCAAACTTCTTCAACTGCTA
>probe:Drosophila_2:1632531_at:296:195; Interrogation_Position=381; Antisense; AACTGCTACGCGAATGCTGCTGATA
>probe:Drosophila_2:1632531_at:698:335; Interrogation_Position=396; Antisense; GCTGCTGATAATGACGTCTCTGTGA
>probe:Drosophila_2:1632531_at:200:499; Interrogation_Position=411; Antisense; GTCTCTGTGATCTACAACCTGGCCA
>probe:Drosophila_2:1632531_at:589:251; Interrogation_Position=514; Antisense; CAACGCAGAACAACTACGTCCGGGA
>probe:Drosophila_2:1632531_at:65:139; Interrogation_Position=553; Antisense; ACGATCTGCTGGACAATTGCCTCAA
>probe:Drosophila_2:1632531_at:515:651; Interrogation_Position=574; Antisense; TCAAGAATGGAGTGCCCACCACTAC
>probe:Drosophila_2:1632531_at:216:651; Interrogation_Position=623; Antisense; TCAAACTACCTCTACCACAGACGGG
>probe:Drosophila_2:1632531_at:676:537; Interrogation_Position=648; Antisense; GGTTTCCTATTTGGCCTTTGAGTAG
>probe:Drosophila_2:1632531_at:208:579; Interrogation_Position=660; Antisense; GGCCTTTGAGTAGTTAGCATTCGAA
>probe:Drosophila_2:1632531_at:246:541; Interrogation_Position=791; Antisense; GGTTTTATACTGCAGACATCGCCAA
>probe:Drosophila_2:1632531_at:482:169; Interrogation_Position=881; Antisense; AAAGTCGCATTGGTTTCAGTCGTTT

Paste this into a BLAST search page for me
GTTTCAACACTCTGCAGTGCCTTTATTACCGCCTGCGACAGCAACAATGAATACCGCAAACTTCTTCAACTGCTAAACTGCTACGCGAATGCTGCTGATAGCTGCTGATAATGACGTCTCTGTGAGTCTCTGTGATCTACAACCTGGCCACAACGCAGAACAACTACGTCCGGGAACGATCTGCTGGACAATTGCCTCAATCAAGAATGGAGTGCCCACCACTACTCAAACTACCTCTACCACAGACGGGGGTTTCCTATTTGGCCTTTGAGTAGGGCCTTTGAGTAGTTAGCATTCGAAGGTTTTATACTGCAGACATCGCCAAAAAGTCGCATTGGTTTCAGTCGTTT

Full Affymetrix probeset data:

Annotations for 1632531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720