Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632532_s_at:

>probe:Drosophila_2:1632532_s_at:210:691; Interrogation_Position=1036; Antisense; TATTGGCATCGTGGCAGATCTTTTC
>probe:Drosophila_2:1632532_s_at:379:95; Interrogation_Position=1051; Antisense; AGATCTTTTCAAGGCCGTGCCCGAA
>probe:Drosophila_2:1632532_s_at:187:71; Interrogation_Position=1093; Antisense; AGGCGAGATTGTCACTTGCTGTAGT
>probe:Drosophila_2:1632532_s_at:363:205; Interrogation_Position=1214; Antisense; AAGCCGAAGACCTATTCTATGTGAA
>probe:Drosophila_2:1632532_s_at:358:313; Interrogation_Position=677; Antisense; GCCAGCAGCCTGTCCGAATTTGTAT
>probe:Drosophila_2:1632532_s_at:264:363; Interrogation_Position=692; Antisense; GAATTTGTATCCCAGGAGCTGACCA
>probe:Drosophila_2:1632532_s_at:308:307; Interrogation_Position=743; Antisense; GCCAAGGTTATTGTGTCCGGAGGAC
>probe:Drosophila_2:1632532_s_at:226:711; Interrogation_Position=791; Antisense; TTCAAGCTGCTGTATGATCTGGCCG
>probe:Drosophila_2:1632532_s_at:30:627; Interrogation_Position=850; Antisense; TGCCGTGGATGCTGGATTTGTGCCC
>probe:Drosophila_2:1632532_s_at:699:19; Interrogation_Position=865; Antisense; ATTTGTGCCCAATGATCTGCAGATC
>probe:Drosophila_2:1632532_s_at:165:497; Interrogation_Position=891; Antisense; GTCAGACCGGCAAGATTGTGGCTCC
>probe:Drosophila_2:1632532_s_at:589:303; Interrogation_Position=915; Antisense; CCGAGCTGTACATCGCTGTCGGAAT
>probe:Drosophila_2:1632532_s_at:721:353; Interrogation_Position=955; Antisense; GCACTTGGCTGGCATGAAGGACTCC
>probe:Drosophila_2:1632532_s_at:396:225; Interrogation_Position=971; Antisense; AAGGACTCCAAGACGATTGTGGCCA

Paste this into a BLAST search page for me
TATTGGCATCGTGGCAGATCTTTTCAGATCTTTTCAAGGCCGTGCCCGAAAGGCGAGATTGTCACTTGCTGTAGTAAGCCGAAGACCTATTCTATGTGAAGCCAGCAGCCTGTCCGAATTTGTATGAATTTGTATCCCAGGAGCTGACCAGCCAAGGTTATTGTGTCCGGAGGACTTCAAGCTGCTGTATGATCTGGCCGTGCCGTGGATGCTGGATTTGTGCCCATTTGTGCCCAATGATCTGCAGATCGTCAGACCGGCAAGATTGTGGCTCCCCGAGCTGTACATCGCTGTCGGAATGCACTTGGCTGGCATGAAGGACTCCAAGGACTCCAAGACGATTGTGGCCA

Full Affymetrix probeset data:

Annotations for 1632532_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime