Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632533_at:

>probe:Drosophila_2:1632533_at:266:659; Interrogation_Position=1280; Antisense; TAAGCCCGATATGAAGTCCAACGCT
>probe:Drosophila_2:1632533_at:406:457; Interrogation_Position=1287; Antisense; GATATGAAGTCCAACGCTACTCACC
>probe:Drosophila_2:1632533_at:439:199; Interrogation_Position=1299; Antisense; AACGCTACTCACCTGGAACTGATAG
>probe:Drosophila_2:1632533_at:37:341; Interrogation_Position=1302; Antisense; GCTACTCACCTGGAACTGATAGATA
>probe:Drosophila_2:1632533_at:192:143; Interrogation_Position=1316; Antisense; ACTGATAGATAGAGTGCAGCGAATT
>probe:Drosophila_2:1632533_at:209:123; Interrogation_Position=1333; Antisense; AGCGAATTAATGCTGGGCACTCCGC
>probe:Drosophila_2:1632533_at:459:219; Interrogation_Position=1341; Antisense; AATGCTGGGCACTCCGCCGTACTTT
>probe:Drosophila_2:1632533_at:570:299; Interrogation_Position=1356; Antisense; GCCGTACTTTAAACCCAAGATCGTG
>probe:Drosophila_2:1632533_at:603:675; Interrogation_Position=1363; Antisense; TTTAAACCCAAGATCGTGGAACGAT
>probe:Drosophila_2:1632533_at:316:383; Interrogation_Position=1381; Antisense; GAACGATAGTCACTGGATCCGTCGC
>probe:Drosophila_2:1632533_at:730:457; Interrogation_Position=1385; Antisense; GATAGTCACTGGATCCGTCGCGCGG
>probe:Drosophila_2:1632533_at:432:651; Interrogation_Position=1390; Antisense; TCACTGGATCCGTCGCGCGGCGGCT
>probe:Drosophila_2:1632533_at:33:333; Interrogation_Position=1406; Antisense; GCGGCGGCTGACGAATGAGCACAAA
>probe:Drosophila_2:1632533_at:693:365; Interrogation_Position=1418; Antisense; GAATGAGCACAAAGTCCGGGCGGAA

Paste this into a BLAST search page for me
TAAGCCCGATATGAAGTCCAACGCTGATATGAAGTCCAACGCTACTCACCAACGCTACTCACCTGGAACTGATAGGCTACTCACCTGGAACTGATAGATAACTGATAGATAGAGTGCAGCGAATTAGCGAATTAATGCTGGGCACTCCGCAATGCTGGGCACTCCGCCGTACTTTGCCGTACTTTAAACCCAAGATCGTGTTTAAACCCAAGATCGTGGAACGATGAACGATAGTCACTGGATCCGTCGCGATAGTCACTGGATCCGTCGCGCGGTCACTGGATCCGTCGCGCGGCGGCTGCGGCGGCTGACGAATGAGCACAAAGAATGAGCACAAAGTCCGGGCGGAA

Full Affymetrix probeset data:

Annotations for 1632533_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime