FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632534_at:

>probe:Drosophila_2:1632534_at:456:729; Interrogation_Position=339; Antisense; TTGGCGATATCGACAGCAGCATGTT
>probe:Drosophila_2:1632534_at:649:235; Interrogation_Position=402; Antisense; AATCCGGATCGGGTGACATAGACAT
>probe:Drosophila_2:1632534_at:99:381; Interrogation_Position=445; Antisense; GAACCAGCTGGACGCGATCATCGTT
>probe:Drosophila_2:1632534_at:151:467; Interrogation_Position=472; Antisense; GATTGGCCAGTTCGGACATTTTCAA
>probe:Drosophila_2:1632534_at:405:701; Interrogation_Position=542; Antisense; TTTTACTCCATTTCCTACGTCTTCA
>probe:Drosophila_2:1632534_at:185:381; Interrogation_Position=632; Antisense; GAACCATTCCTAAATTTCACCACTC
>probe:Drosophila_2:1632534_at:387:197; Interrogation_Position=660; Antisense; AACGTCACGGCAACTGGGCTCAATG
>probe:Drosophila_2:1632534_at:11:231; Interrogation_Position=681; Antisense; AATGTGAGCAGTACGCCGTGCGATC
>probe:Drosophila_2:1632534_at:543:507; Interrogation_Position=698; Antisense; GTGCGATCCAACCTCGTGGGTCAAC
>probe:Drosophila_2:1632534_at:438:593; Interrogation_Position=714; Antisense; TGGGTCAACCTTCGTGCAATGTCAG
>probe:Drosophila_2:1632534_at:297:693; Interrogation_Position=743; Antisense; TTTGATGTTGGTCAGAGGGTCCCCT
>probe:Drosophila_2:1632534_at:659:535; Interrogation_Position=760; Antisense; GGTCCCCTGCGATGCTGGCTATAAG
>probe:Drosophila_2:1632534_at:246:191; Interrogation_Position=821; Antisense; AACATTTTCTGCTTTGACCAGTGGA
>probe:Drosophila_2:1632534_at:451:529; Interrogation_Position=889; Antisense; GGGTTATCTAGCCAATCCGTGAGAA

Paste this into a BLAST search page for me
TTGGCGATATCGACAGCAGCATGTTAATCCGGATCGGGTGACATAGACATGAACCAGCTGGACGCGATCATCGTTGATTGGCCAGTTCGGACATTTTCAATTTTACTCCATTTCCTACGTCTTCAGAACCATTCCTAAATTTCACCACTCAACGTCACGGCAACTGGGCTCAATGAATGTGAGCAGTACGCCGTGCGATCGTGCGATCCAACCTCGTGGGTCAACTGGGTCAACCTTCGTGCAATGTCAGTTTGATGTTGGTCAGAGGGTCCCCTGGTCCCCTGCGATGCTGGCTATAAGAACATTTTCTGCTTTGACCAGTGGAGGGTTATCTAGCCAATCCGTGAGAA

Full Affymetrix probeset data:

Annotations for 1632534_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720