FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632535_at:

>probe:Drosophila_2:1632535_at:719:167; Interrogation_Position=1034; Antisense; AAATGGAGGGCAACCTGTTCGTCCT
>probe:Drosophila_2:1632535_at:549:119; Interrogation_Position=1060; Antisense; AGCTGCGATCTCAGTGGACAGGCCT
>probe:Drosophila_2:1632535_at:119:559; Interrogation_Position=1075; Antisense; GGACAGGCCTTTTATCACGATATGC
>probe:Drosophila_2:1632535_at:571:457; Interrogation_Position=1128; Antisense; GATAGTACAAATTCCACTTCCCTTT
>probe:Drosophila_2:1632535_at:665:175; Interrogation_Position=1155; Antisense; AAACGTAATCGCCTGTAGTCGGGAT
>probe:Drosophila_2:1632535_at:557:57; Interrogation_Position=1253; Antisense; ATGTCAAGGGAGGACTTCGCGGCAA
>probe:Drosophila_2:1632535_at:582:379; Interrogation_Position=1280; Antisense; GAAGCCTTATCCGTAGTAGCGACAA
>probe:Drosophila_2:1632535_at:302:409; Interrogation_Position=1307; Antisense; GACGCTGGTTAATTGCAGGCCTCTA
>probe:Drosophila_2:1632535_at:683:315; Interrogation_Position=1325; Antisense; GCCTCTATGGCGACGAGTTCCAGAT
>probe:Drosophila_2:1632535_at:5:69; Interrogation_Position=820; Antisense; ATGGCTCTGGATTGGGAATACACCC
>probe:Drosophila_2:1632535_at:519:103; Interrogation_Position=864; Antisense; AGAGCCTACGGCAATGGTGACCCTT
>probe:Drosophila_2:1632535_at:452:547; Interrogation_Position=894; Antisense; GGATGACTTCGTCGTGGGCACTAAC
>probe:Drosophila_2:1632535_at:321:95; Interrogation_Position=974; Antisense; AGATCAAATTGTTGGCCCTACGGCG
>probe:Drosophila_2:1632535_at:98:575; Interrogation_Position=995; Antisense; GGCGACATCGATTCATGGTTTCCAC

Paste this into a BLAST search page for me
AAATGGAGGGCAACCTGTTCGTCCTAGCTGCGATCTCAGTGGACAGGCCTGGACAGGCCTTTTATCACGATATGCGATAGTACAAATTCCACTTCCCTTTAAACGTAATCGCCTGTAGTCGGGATATGTCAAGGGAGGACTTCGCGGCAAGAAGCCTTATCCGTAGTAGCGACAAGACGCTGGTTAATTGCAGGCCTCTAGCCTCTATGGCGACGAGTTCCAGATATGGCTCTGGATTGGGAATACACCCAGAGCCTACGGCAATGGTGACCCTTGGATGACTTCGTCGTGGGCACTAACAGATCAAATTGTTGGCCCTACGGCGGGCGACATCGATTCATGGTTTCCAC

Full Affymetrix probeset data:

Annotations for 1632535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720