FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632538_at:

>probe:Drosophila_2:1632538_at:116:43; Interrogation_Position=332; Antisense; ATCGAGCTTATTTGGGCGACCTGCA
>probe:Drosophila_2:1632538_at:680:205; Interrogation_Position=424; Antisense; AAGCTGGGCAGCTCGATGCACAGCA
>probe:Drosophila_2:1632538_at:421:53; Interrogation_Position=439; Antisense; ATGCACAGCATCAAGACCTTCTGGT
>probe:Drosophila_2:1632538_at:391:639; Interrogation_Position=458; Antisense; TCTGGTCGCCGGAGCTCAAGAAGGA
>probe:Drosophila_2:1632538_at:522:425; Interrogation_Position=502; Antisense; GAGAGCGCCAAGTACAGTCTGATCA
>probe:Drosophila_2:1632538_at:295:207; Interrogation_Position=538; Antisense; AAGCTGCTCAGCACGGAGAACCAGA
>probe:Drosophila_2:1632538_at:257:389; Interrogation_Position=561; Antisense; GAAACAAGCTATGCTGGTGCGCCAG
>probe:Drosophila_2:1632538_at:23:77; Interrogation_Position=593; Antisense; AGGAGCTGCGCCTGCGAATGCGACA
>probe:Drosophila_2:1632538_at:702:231; Interrogation_Position=609; Antisense; AATGCGACAGCCCAACCTGGAGATG
>probe:Drosophila_2:1632538_at:646:449; Interrogation_Position=651; Antisense; GATCTACGCGGAGAACGACCACTTG
>probe:Drosophila_2:1632538_at:723:197; Interrogation_Position=664; Antisense; AACGACCACTTGCAGCGGGAGATCA
>probe:Drosophila_2:1632538_at:337:115; Interrogation_Position=688; Antisense; AGCATCCTGCGCGAGACGATCAAGG
>probe:Drosophila_2:1632538_at:94:465; Interrogation_Position=750; Antisense; GATTGCCCGCGACGAGAGTATCAAG
>probe:Drosophila_2:1632538_at:366:59; Interrogation_Position=829; Antisense; ATGTTCCAGCAGATGCAGGCCATGG

Paste this into a BLAST search page for me
ATCGAGCTTATTTGGGCGACCTGCAAAGCTGGGCAGCTCGATGCACAGCAATGCACAGCATCAAGACCTTCTGGTTCTGGTCGCCGGAGCTCAAGAAGGAGAGAGCGCCAAGTACAGTCTGATCAAAGCTGCTCAGCACGGAGAACCAGAGAAACAAGCTATGCTGGTGCGCCAGAGGAGCTGCGCCTGCGAATGCGACAAATGCGACAGCCCAACCTGGAGATGGATCTACGCGGAGAACGACCACTTGAACGACCACTTGCAGCGGGAGATCAAGCATCCTGCGCGAGACGATCAAGGGATTGCCCGCGACGAGAGTATCAAGATGTTCCAGCAGATGCAGGCCATGG

Full Affymetrix probeset data:

Annotations for 1632538_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720