FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632539_at:

>probe:Drosophila_2:1632539_at:208:91; Interrogation_Position=245; Antisense; AGTACGCGCCAAGCGATGAGCTCTA
>probe:Drosophila_2:1632539_at:526:39; Interrogation_Position=278; Antisense; ATCTGCTGCAGCGTGCCAAAGTGGA
>probe:Drosophila_2:1632539_at:605:603; Interrogation_Position=308; Antisense; TGATGCACTTCGAGTCGGGTGTCAT
>probe:Drosophila_2:1632539_at:17:647; Interrogation_Position=329; Antisense; TCATCTTCGAGTCTGCCCTAAGGAG
>probe:Drosophila_2:1632539_at:198:723; Interrogation_Position=391; Antisense; TTGCCCCGCAATCAGGTGGATCACA
>probe:Drosophila_2:1632539_at:266:519; Interrogation_Position=406; Antisense; GTGGATCACATCCTTCAGGTCTATG
>probe:Drosophila_2:1632539_at:497:425; Interrogation_Position=439; Antisense; GAGACCTTTCTCGATGATCACGACT
>probe:Drosophila_2:1632539_at:574:581; Interrogation_Position=467; Antisense; TGGCCGGCGATCAGTTGACCATAGC
>probe:Drosophila_2:1632539_at:516:17; Interrogation_Position=494; Antisense; ATTTCAGCATCGTATCGACCATCAC
>probe:Drosophila_2:1632539_at:601:127; Interrogation_Position=517; Antisense; ACCTCGATTGGTGTTTTCCTGGAGC
>probe:Drosophila_2:1632539_at:297:449; Interrogation_Position=544; Antisense; GATCCGGCCAAGTACCCTAAGATTG
>probe:Drosophila_2:1632539_at:257:425; Interrogation_Position=580; Antisense; GAGAGGCTTAAGGAGCTGCCCTACT
>probe:Drosophila_2:1632539_at:541:91; Interrogation_Position=635; Antisense; AGTTCGTGGAGCTCTTGAGGTCCAA
>probe:Drosophila_2:1632539_at:549:545; Interrogation_Position=87; Antisense; GGATCTGCCCTTCGAATTTGTGTTC

Paste this into a BLAST search page for me
AGTACGCGCCAAGCGATGAGCTCTAATCTGCTGCAGCGTGCCAAAGTGGATGATGCACTTCGAGTCGGGTGTCATTCATCTTCGAGTCTGCCCTAAGGAGTTGCCCCGCAATCAGGTGGATCACAGTGGATCACATCCTTCAGGTCTATGGAGACCTTTCTCGATGATCACGACTTGGCCGGCGATCAGTTGACCATAGCATTTCAGCATCGTATCGACCATCACACCTCGATTGGTGTTTTCCTGGAGCGATCCGGCCAAGTACCCTAAGATTGGAGAGGCTTAAGGAGCTGCCCTACTAGTTCGTGGAGCTCTTGAGGTCCAAGGATCTGCCCTTCGAATTTGTGTTC

Full Affymetrix probeset data:

Annotations for 1632539_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720