FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632540_at:

>probe:Drosophila_2:1632540_at:637:277; Interrogation_Position=241; Antisense; CTACATGAGAGATCCGTGACGCTGA
>probe:Drosophila_2:1632540_at:86:111; Interrogation_Position=287; Antisense; AGAATCACAACTACGGCGGCACATT
>probe:Drosophila_2:1632540_at:610:3; Interrogation_Position=309; Antisense; ATTGGTTCCTGTGGCGGCGTACAAA
>probe:Drosophila_2:1632540_at:314:171; Interrogation_Position=331; Antisense; AAAGTCCACGAGCAGTTTGATTCCC
>probe:Drosophila_2:1632540_at:243:103; Interrogation_Position=421; Antisense; AGAGCCATCAATTTAGCCAGTACGA
>probe:Drosophila_2:1632540_at:421:127; Interrogation_Position=435; Antisense; AGCCAGTACGAGTCCATCGGGTGGA
>probe:Drosophila_2:1632540_at:331:631; Interrogation_Position=508; Antisense; TCCGATAGCTTGCAGAAGGCCCAGT
>probe:Drosophila_2:1632540_at:27:227; Interrogation_Position=523; Antisense; AAGGCCCAGTTGCAGATCATCGATC
>probe:Drosophila_2:1632540_at:418:45; Interrogation_Position=545; Antisense; ATCGCGGAGAGTGTGCCTCGCAAAA
>probe:Drosophila_2:1632540_at:22:75; Interrogation_Position=599; Antisense; AGGAAACAATTTGCGCTGCCAGCAC
>probe:Drosophila_2:1632540_at:373:617; Interrogation_Position=627; Antisense; TGCAGATGCCTGTACGGGAGACTCT
>probe:Drosophila_2:1632540_at:171:435; Interrogation_Position=653; Antisense; GAGGTCCTTTGGTGGCCAGTAGCCA
>probe:Drosophila_2:1632540_at:704:529; Interrogation_Position=700; Antisense; GGTTACCGGTGTGCGGACGACAACT
>probe:Drosophila_2:1632540_at:468:63; Interrogation_Position=743; Antisense; ATGTGGCGATTCTGCGACCTTGGAT

Paste this into a BLAST search page for me
CTACATGAGAGATCCGTGACGCTGAAGAATCACAACTACGGCGGCACATTATTGGTTCCTGTGGCGGCGTACAAAAAAGTCCACGAGCAGTTTGATTCCCAGAGCCATCAATTTAGCCAGTACGAAGCCAGTACGAGTCCATCGGGTGGATCCGATAGCTTGCAGAAGGCCCAGTAAGGCCCAGTTGCAGATCATCGATCATCGCGGAGAGTGTGCCTCGCAAAAAGGAAACAATTTGCGCTGCCAGCACTGCAGATGCCTGTACGGGAGACTCTGAGGTCCTTTGGTGGCCAGTAGCCAGGTTACCGGTGTGCGGACGACAACTATGTGGCGATTCTGCGACCTTGGAT

Full Affymetrix probeset data:

Annotations for 1632540_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720