FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632541_at:

>probe:Drosophila_2:1632541_at:359:53; Interrogation_Position=3794; Antisense; ATGCATCCTGCTGTGCATCCGGGAT
>probe:Drosophila_2:1632541_at:483:47; Interrogation_Position=3810; Antisense; ATCCGGGATTGAGGCACCTCTCGAG
>probe:Drosophila_2:1632541_at:690:593; Interrogation_Position=3867; Antisense; TGGGCAATCACATGGCGCCACAACA
>probe:Drosophila_2:1632541_at:178:709; Interrogation_Position=3950; Antisense; TTACTGATGACCCAGCATTCGGTGG
>probe:Drosophila_2:1632541_at:329:69; Interrogation_Position=4065; Antisense; ATGGCCACGCACATCCGTTGCAGAT
>probe:Drosophila_2:1632541_at:158:189; Interrogation_Position=4110; Antisense; AACAGCAGCACTCGCCCAAGGGACT
>probe:Drosophila_2:1632541_at:44:223; Interrogation_Position=4127; Antisense; AAGGGACTCAAATCCCTGCCGGAAT
>probe:Drosophila_2:1632541_at:215:67; Interrogation_Position=4167; Antisense; ATGGACAGCATGTGCAGGCCCAGGA
>probe:Drosophila_2:1632541_at:136:71; Interrogation_Position=4182; Antisense; AGGCCCAGGAGAGCAGACCATCGGT
>probe:Drosophila_2:1632541_at:44:415; Interrogation_Position=4197; Antisense; GACCATCGGTCATTGAGTCCTCCAA
>probe:Drosophila_2:1632541_at:571:201; Interrogation_Position=4220; Antisense; AACCAGCCCATGATCATCGAATGCA
>probe:Drosophila_2:1632541_at:154:491; Interrogation_Position=4260; Antisense; GTACATGGTATATGGAGCAGCTGCA
>probe:Drosophila_2:1632541_at:469:335; Interrogation_Position=4279; Antisense; GCTGCAGACCAGACCAGGAAGTGAT
>probe:Drosophila_2:1632541_at:610:397; Interrogation_Position=4352; Antisense; GACAGACAGACGATACCCCTTAAAA

Paste this into a BLAST search page for me
ATGCATCCTGCTGTGCATCCGGGATATCCGGGATTGAGGCACCTCTCGAGTGGGCAATCACATGGCGCCACAACATTACTGATGACCCAGCATTCGGTGGATGGCCACGCACATCCGTTGCAGATAACAGCAGCACTCGCCCAAGGGACTAAGGGACTCAAATCCCTGCCGGAATATGGACAGCATGTGCAGGCCCAGGAAGGCCCAGGAGAGCAGACCATCGGTGACCATCGGTCATTGAGTCCTCCAAAACCAGCCCATGATCATCGAATGCAGTACATGGTATATGGAGCAGCTGCAGCTGCAGACCAGACCAGGAAGTGATGACAGACAGACGATACCCCTTAAAA

Full Affymetrix probeset data:

Annotations for 1632541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720