Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632543_at:

>probe:Drosophila_2:1632543_at:286:37; Interrogation_Position=1034; Antisense; ATCATCTACTGAACACCCTGGAGGT
>probe:Drosophila_2:1632543_at:144:433; Interrogation_Position=1054; Antisense; GAGGTATCCGGGTGTCGCAACTTCA
>probe:Drosophila_2:1632543_at:117:191; Interrogation_Position=1072; Antisense; AACTTCACGGACATTGGCTTCCAGG
>probe:Drosophila_2:1632543_at:27:549; Interrogation_Position=1140; Antisense; GGAGTGCAGCCAGATTACAGACCTA
>probe:Drosophila_2:1632543_at:145:667; Interrogation_Position=1155; Antisense; TACAGACCTAACGTTGGCTCATCTT
>probe:Drosophila_2:1632543_at:317:573; Interrogation_Position=1186; Antisense; GGCTGTCCCAGCTTAGAGAAATTGA
>probe:Drosophila_2:1632543_at:399:423; Interrogation_Position=1201; Antisense; GAGAAATTGACCCTATCGCACTGTG
>probe:Drosophila_2:1632543_at:441:139; Interrogation_Position=1234; Antisense; ACGGACGATGGTATTCGACACCTCA
>probe:Drosophila_2:1632543_at:502:161; Interrogation_Position=1280; Antisense; AAATTCTGTCCGTGCTGGAGCTAGA
>probe:Drosophila_2:1632543_at:552:455; Interrogation_Position=1317; Antisense; GATAACCGACCGAACGCTAGAGCAT
>probe:Drosophila_2:1632543_at:275:677; Interrogation_Position=1334; Antisense; TAGAGCATTTGGTGTCCTGCCACAA
>probe:Drosophila_2:1632543_at:326:39; Interrogation_Position=1358; Antisense; ATCTGCAGCGCATCGAGTTATTCGA
>probe:Drosophila_2:1632543_at:72:243; Interrogation_Position=1435; Antisense; AATATCAAGGTGCACGCCTACTTCG
>probe:Drosophila_2:1632543_at:106:723; Interrogation_Position=1506; Antisense; TTGCCGCTGCTGTGAGATTCTCTGA

Paste this into a BLAST search page for me
ATCATCTACTGAACACCCTGGAGGTGAGGTATCCGGGTGTCGCAACTTCAAACTTCACGGACATTGGCTTCCAGGGGAGTGCAGCCAGATTACAGACCTATACAGACCTAACGTTGGCTCATCTTGGCTGTCCCAGCTTAGAGAAATTGAGAGAAATTGACCCTATCGCACTGTGACGGACGATGGTATTCGACACCTCAAAATTCTGTCCGTGCTGGAGCTAGAGATAACCGACCGAACGCTAGAGCATTAGAGCATTTGGTGTCCTGCCACAAATCTGCAGCGCATCGAGTTATTCGAAATATCAAGGTGCACGCCTACTTCGTTGCCGCTGCTGTGAGATTCTCTGA

Full Affymetrix probeset data:

Annotations for 1632543_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime