FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632546_at:

>probe:Drosophila_2:1632546_at:384:381; Interrogation_Position=121; Antisense; GAACCGCCGCAGGATCTGGCGCTTG
>probe:Drosophila_2:1632546_at:90:267; Interrogation_Position=130; Antisense; CAGGATCTGGCGCTTGCCGTTCCGC
>probe:Drosophila_2:1632546_at:383:245; Interrogation_Position=166; Antisense; AATTGCCTGGCCATCCCGATGTCCT
>probe:Drosophila_2:1632546_at:263:45; Interrogation_Position=178; Antisense; ATCCCGATGTCCTCACTGCAAACGG
>probe:Drosophila_2:1632546_at:36:145; Interrogation_Position=192; Antisense; ACTGCAAACGGCCAATGGACCCGGC
>probe:Drosophila_2:1632546_at:538:223; Interrogation_Position=205; Antisense; AATGGACCCGGCACAAAAGAGTTGC
>probe:Drosophila_2:1632546_at:581:411; Interrogation_Position=209; Antisense; GACCCGGCACAAAAGAGTTGCACAA
>probe:Drosophila_2:1632546_at:11:567; Interrogation_Position=214; Antisense; GGCACAAAAGAGTTGCACAACCCAT
>probe:Drosophila_2:1632546_at:584:535; Interrogation_Position=49; Antisense; GGTCGGCATGCTCGCGTTAGTCCAA
>probe:Drosophila_2:1632546_at:113:53; Interrogation_Position=56; Antisense; ATGCTCGCGTTAGTCCAACGCCAGG
>probe:Drosophila_2:1632546_at:6:707; Interrogation_Position=65; Antisense; TTAGTCCAACGCCAGGACGTGGCAG
>probe:Drosophila_2:1632546_at:589:267; Interrogation_Position=77; Antisense; CAGGACGTGGCAGCAAGATTGCGTA
>probe:Drosophila_2:1632546_at:686:583; Interrogation_Position=84; Antisense; TGGCAGCAAGATTGCGTATACGCCG
>probe:Drosophila_2:1632546_at:358:483; Interrogation_Position=99; Antisense; GTATACGCCGTGTCCGCGCTCCGAA

Paste this into a BLAST search page for me
GAACCGCCGCAGGATCTGGCGCTTGCAGGATCTGGCGCTTGCCGTTCCGCAATTGCCTGGCCATCCCGATGTCCTATCCCGATGTCCTCACTGCAAACGGACTGCAAACGGCCAATGGACCCGGCAATGGACCCGGCACAAAAGAGTTGCGACCCGGCACAAAAGAGTTGCACAAGGCACAAAAGAGTTGCACAACCCATGGTCGGCATGCTCGCGTTAGTCCAAATGCTCGCGTTAGTCCAACGCCAGGTTAGTCCAACGCCAGGACGTGGCAGCAGGACGTGGCAGCAAGATTGCGTATGGCAGCAAGATTGCGTATACGCCGGTATACGCCGTGTCCGCGCTCCGAA

Full Affymetrix probeset data:

Annotations for 1632546_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720