FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632547_at:

>probe:Drosophila_2:1632547_at:351:223; Interrogation_Position=237; Antisense; AAGGATTCTCCGCTGGTTTAATTGA
>probe:Drosophila_2:1632547_at:593:725; Interrogation_Position=297; Antisense; TTGGACCGCCAGATACACTGTACGA
>probe:Drosophila_2:1632547_at:350:549; Interrogation_Position=323; Antisense; GGAGGATTCTTTAAAGCTCATCTTT
>probe:Drosophila_2:1632547_at:148:663; Interrogation_Position=355; Antisense; TAAAGAATATCCGTTGCGTCCTCCT
>probe:Drosophila_2:1632547_at:297:329; Interrogation_Position=370; Antisense; GCGTCCTCCTCGAATGAAGTTTGTT
>probe:Drosophila_2:1632547_at:341:481; Interrogation_Position=388; Antisense; GTTTGTTACAGAAATTTGGCACCCA
>probe:Drosophila_2:1632547_at:602:277; Interrogation_Position=444; Antisense; CTATTTTACATGAGCCTGGAGACGA
>probe:Drosophila_2:1632547_at:306:183; Interrogation_Position=484; Antisense; AAAAGCATCGGAGCGCTGGTTACCC
>probe:Drosophila_2:1632547_at:307:473; Interrogation_Position=502; Antisense; GTTACCCGTGCATACAGTGGAGACT
>probe:Drosophila_2:1632547_at:611:493; Interrogation_Position=539; Antisense; GTAATATCAATGCTGGCCGATCCGA
>probe:Drosophila_2:1632547_at:629:577; Interrogation_Position=553; Antisense; GGCCGATCCGAACGATGAGTCTCCA
>probe:Drosophila_2:1632547_at:681:63; Interrogation_Position=601; Antisense; ATGGCGAGAATCCTATACCGACTTT
>probe:Drosophila_2:1632547_at:236:255; Interrogation_Position=631; Antisense; CAAAGTTGCTCGCTGCGTCAGAAAA
>probe:Drosophila_2:1632547_at:13:289; Interrogation_Position=679; Antisense; CGGCCCGCCCTATATTTGTATATTT

Paste this into a BLAST search page for me
AAGGATTCTCCGCTGGTTTAATTGATTGGACCGCCAGATACACTGTACGAGGAGGATTCTTTAAAGCTCATCTTTTAAAGAATATCCGTTGCGTCCTCCTGCGTCCTCCTCGAATGAAGTTTGTTGTTTGTTACAGAAATTTGGCACCCACTATTTTACATGAGCCTGGAGACGAAAAAGCATCGGAGCGCTGGTTACCCGTTACCCGTGCATACAGTGGAGACTGTAATATCAATGCTGGCCGATCCGAGGCCGATCCGAACGATGAGTCTCCAATGGCGAGAATCCTATACCGACTTTCAAAGTTGCTCGCTGCGTCAGAAAACGGCCCGCCCTATATTTGTATATTT

Full Affymetrix probeset data:

Annotations for 1632547_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720