Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632550_at:

>probe:Drosophila_2:1632550_at:184:119; Interrogation_Position=4450; Antisense; AGCGTTTAATTATACTTGTGGCTTA
>probe:Drosophila_2:1632550_at:422:187; Interrogation_Position=4492; Antisense; AACACATAACTCTAGCATTACGGTG
>probe:Drosophila_2:1632550_at:345:481; Interrogation_Position=4524; Antisense; GTTTGTGTACGATACGACAGCTGTA
>probe:Drosophila_2:1632550_at:526:399; Interrogation_Position=4539; Antisense; GACAGCTGTAAGATACGAGTTCACA
>probe:Drosophila_2:1632550_at:427:513; Interrogation_Position=4594; Antisense; GTGATGGCCAACTACGAAAGACAAC
>probe:Drosophila_2:1632550_at:114:331; Interrogation_Position=4641; Antisense; GCGGTAGTTGTAAACTGTTTGCCAA
>probe:Drosophila_2:1632550_at:76:481; Interrogation_Position=4657; Antisense; GTTTGCCAAATCGTTGAATTTCTCA
>probe:Drosophila_2:1632550_at:220:17; Interrogation_Position=4674; Antisense; ATTTCTCAACCGACTCTAGGTACGA
>probe:Drosophila_2:1632550_at:290:673; Interrogation_Position=4755; Antisense; TACCCTAAAGTATGTAGCCTCTCAA
>probe:Drosophila_2:1632550_at:556:399; Interrogation_Position=4877; Antisense; GACATACTCAAGTGATAACCTTTGT
>probe:Drosophila_2:1632550_at:663:453; Interrogation_Position=4890; Antisense; GATAACCTTTGTATTTGTCTTTAGA
>probe:Drosophila_2:1632550_at:606:441; Interrogation_Position=4913; Antisense; GATGTAAGTCTGATCCTGTCGTTTA
>probe:Drosophila_2:1632550_at:345:449; Interrogation_Position=4924; Antisense; GATCCTGTCGTTTAATCGTTAATCA
>probe:Drosophila_2:1632550_at:119:55; Interrogation_Position=4968; Antisense; ATGACGTATACTTAGTGGCTCAAAC

Paste this into a BLAST search page for me
AGCGTTTAATTATACTTGTGGCTTAAACACATAACTCTAGCATTACGGTGGTTTGTGTACGATACGACAGCTGTAGACAGCTGTAAGATACGAGTTCACAGTGATGGCCAACTACGAAAGACAACGCGGTAGTTGTAAACTGTTTGCCAAGTTTGCCAAATCGTTGAATTTCTCAATTTCTCAACCGACTCTAGGTACGATACCCTAAAGTATGTAGCCTCTCAAGACATACTCAAGTGATAACCTTTGTGATAACCTTTGTATTTGTCTTTAGAGATGTAAGTCTGATCCTGTCGTTTAGATCCTGTCGTTTAATCGTTAATCAATGACGTATACTTAGTGGCTCAAAC

Full Affymetrix probeset data:

Annotations for 1632550_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime