FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632551_at:

>probe:Drosophila_2:1632551_at:78:151; Interrogation_Position=1084; Antisense; ACATGCACGGGTCAACCTTTACGAT
>probe:Drosophila_2:1632551_at:530:273; Interrogation_Position=1138; Antisense; CTTTCCGGGAAGGACGCGAAGTCAT
>probe:Drosophila_2:1632551_at:619:67; Interrogation_Position=1164; Antisense; ATGGCTTGTCGCCAGTGTACAGCCT
>probe:Drosophila_2:1632551_at:57:317; Interrogation_Position=1185; Antisense; GCCTCGCCTGTGATAGCCAATATAT
>probe:Drosophila_2:1632551_at:214:523; Interrogation_Position=1214; Antisense; GTGGCCACCGATCACAATATGCGTG
>probe:Drosophila_2:1632551_at:14:329; Interrogation_Position=1234; Antisense; GCGTGTCTTTGACTTTAAGGCAAGC
>probe:Drosophila_2:1632551_at:430:373; Interrogation_Position=1368; Antisense; GAAGAAACCAAATGCGCCGTACAAA
>probe:Drosophila_2:1632551_at:114:253; Interrogation_Position=1401; Antisense; CAAGATGTCTGCTGATTTCCCGTAA
>probe:Drosophila_2:1632551_at:599:121; Interrogation_Position=1426; Antisense; AGCGTACTATTTGTTCTTATCAGAA
>probe:Drosophila_2:1632551_at:515:159; Interrogation_Position=1450; Antisense; ACAACTCGTGTCTAGTTTATTACGG
>probe:Drosophila_2:1632551_at:34:423; Interrogation_Position=1532; Antisense; GAGAAGGCTATTACCGTCTTGTTTT
>probe:Drosophila_2:1632551_at:205:37; Interrogation_Position=1565; Antisense; ATCATCATACCATCAGTTTGTGTAG
>probe:Drosophila_2:1632551_at:638:385; Interrogation_Position=1589; Antisense; GAACAAGTTTTATTGACCTGTCCAC
>probe:Drosophila_2:1632551_at:400:413; Interrogation_Position=1603; Antisense; GACCTGTCCACGAATTGGATCCTAA

Paste this into a BLAST search page for me
ACATGCACGGGTCAACCTTTACGATCTTTCCGGGAAGGACGCGAAGTCATATGGCTTGTCGCCAGTGTACAGCCTGCCTCGCCTGTGATAGCCAATATATGTGGCCACCGATCACAATATGCGTGGCGTGTCTTTGACTTTAAGGCAAGCGAAGAAACCAAATGCGCCGTACAAACAAGATGTCTGCTGATTTCCCGTAAAGCGTACTATTTGTTCTTATCAGAAACAACTCGTGTCTAGTTTATTACGGGAGAAGGCTATTACCGTCTTGTTTTATCATCATACCATCAGTTTGTGTAGGAACAAGTTTTATTGACCTGTCCACGACCTGTCCACGAATTGGATCCTAA

Full Affymetrix probeset data:

Annotations for 1632551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720