FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632552_at:

>probe:Drosophila_2:1632552_at:12:171; Interrogation_Position=3747; Antisense; AAAGGGCCAGGCCTTTGATTCGCTG
>probe:Drosophila_2:1632552_at:69:465; Interrogation_Position=3763; Antisense; GATTCGCTGGCCAACTTTTATGCCA
>probe:Drosophila_2:1632552_at:256:493; Interrogation_Position=3827; Antisense; GTAAGGCTCTAACCGCCATGCAGGA
>probe:Drosophila_2:1632552_at:343:167; Interrogation_Position=3859; Antisense; AAATGCCTGGAGAAGCTCAGCCACG
>probe:Drosophila_2:1632552_at:91:353; Interrogation_Position=3911; Antisense; GCACGGTCGCGGATGTTAAGGCAAT
>probe:Drosophila_2:1632552_at:705:51; Interrogation_Position=4000; Antisense; ATGCTGATTAAACCCGAACTGCCGC
>probe:Drosophila_2:1632552_at:201:21; Interrogation_Position=4040; Antisense; ATATCTTGGCCATGCTAATCCGAGC
>probe:Drosophila_2:1632552_at:193:415; Interrogation_Position=4061; Antisense; GAGCCCTGGTCTACGTCAAGGACTA
>probe:Drosophila_2:1632552_at:417:87; Interrogation_Position=4138; Antisense; AGTGCCTCGGGACTCTTGGATCGCA
>probe:Drosophila_2:1632552_at:569:727; Interrogation_Position=4153; Antisense; TTGGATCGCAGCATCGTTCACAAAA
>probe:Drosophila_2:1632552_at:34:163; Interrogation_Position=4175; Antisense; AAATTGCGCAGGAGTGCCACTTGGA
>probe:Drosophila_2:1632552_at:12:453; Interrogation_Position=4204; Antisense; GATCTCATCTGGAATGCGGGACGCC
>probe:Drosophila_2:1632552_at:653:535; Interrogation_Position=4249; Antisense; GGTACGGCCGCCACTGGAATGAGCA
>probe:Drosophila_2:1632552_at:590:263; Interrogation_Position=4272; Antisense; CAGCACTTCTGGGATGACGACTACT

Paste this into a BLAST search page for me
AAAGGGCCAGGCCTTTGATTCGCTGGATTCGCTGGCCAACTTTTATGCCAGTAAGGCTCTAACCGCCATGCAGGAAAATGCCTGGAGAAGCTCAGCCACGGCACGGTCGCGGATGTTAAGGCAATATGCTGATTAAACCCGAACTGCCGCATATCTTGGCCATGCTAATCCGAGCGAGCCCTGGTCTACGTCAAGGACTAAGTGCCTCGGGACTCTTGGATCGCATTGGATCGCAGCATCGTTCACAAAAAAATTGCGCAGGAGTGCCACTTGGAGATCTCATCTGGAATGCGGGACGCCGGTACGGCCGCCACTGGAATGAGCACAGCACTTCTGGGATGACGACTACT

Full Affymetrix probeset data:

Annotations for 1632552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720