FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632554_at:

>probe:Drosophila_2:1632554_at:497:673; Interrogation_Position=1534; Antisense; TACCAAGCTGCCTGCAAGGAGCTGA
>probe:Drosophila_2:1632554_at:611:467; Interrogation_Position=1572; Antisense; GTTGACCATTTTCCTACTCAACATC
>probe:Drosophila_2:1632554_at:443:151; Interrogation_Position=1592; Antisense; ACATCCTCGTGTACAATGCCTATTT
>probe:Drosophila_2:1632554_at:208:235; Interrogation_Position=1606; Antisense; AATGCCTATTTGCTATACTTTGCTA
>probe:Drosophila_2:1632554_at:69:669; Interrogation_Position=1621; Antisense; TACTTTGCTAATGGCCAGAATGCGC
>probe:Drosophila_2:1632554_at:302:369; Interrogation_Position=1638; Antisense; GAATGCGCGAGTCGGACATCTTAAA
>probe:Drosophila_2:1632554_at:684:639; Interrogation_Position=1669; Antisense; TCGGAGTTCCGGGTGATCATCATAA
>probe:Drosophila_2:1632554_at:630:613; Interrogation_Position=1796; Antisense; TGAAGACCATTCTACACGAACCCAT
>probe:Drosophila_2:1632554_at:473:381; Interrogation_Position=1813; Antisense; GAACCCATGCTTATCCAGCAGAACG
>probe:Drosophila_2:1632554_at:82:183; Interrogation_Position=1853; Antisense; AAAACTGCCGCTATTGCCACAAAGG
>probe:Drosophila_2:1632554_at:443:257; Interrogation_Position=1870; Antisense; CACAAAGGCGGAATGCTGCAGTTCA
>probe:Drosophila_2:1632554_at:333:63; Interrogation_Position=1903; Antisense; ATGTGCAACACCTGTCCCGATAAGC
>probe:Drosophila_2:1632554_at:248:455; Interrogation_Position=1921; Antisense; GATAAGCCGGGTCTATGCCAGGAAC
>probe:Drosophila_2:1632554_at:90:631; Interrogation_Position=1952; Antisense; TCCTTCTCTGGCATGAGCAGCTCAA

Paste this into a BLAST search page for me
TACCAAGCTGCCTGCAAGGAGCTGAGTTGACCATTTTCCTACTCAACATCACATCCTCGTGTACAATGCCTATTTAATGCCTATTTGCTATACTTTGCTATACTTTGCTAATGGCCAGAATGCGCGAATGCGCGAGTCGGACATCTTAAATCGGAGTTCCGGGTGATCATCATAATGAAGACCATTCTACACGAACCCATGAACCCATGCTTATCCAGCAGAACGAAAACTGCCGCTATTGCCACAAAGGCACAAAGGCGGAATGCTGCAGTTCAATGTGCAACACCTGTCCCGATAAGCGATAAGCCGGGTCTATGCCAGGAACTCCTTCTCTGGCATGAGCAGCTCAA

Full Affymetrix probeset data:

Annotations for 1632554_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720