Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632556_s_at:

>probe:Drosophila_2:1632556_s_at:224:461; Interrogation_Position=1023; Antisense; GATTATTCACATCGCAAGCCTTTTC
>probe:Drosophila_2:1632556_s_at:376:313; Interrogation_Position=513; Antisense; GCCACCGTCATCTCGACAATAATGG
>probe:Drosophila_2:1632556_s_at:233:239; Interrogation_Position=530; Antisense; AATAATGGCCGTCTACCAACTGGTC
>probe:Drosophila_2:1632556_s_at:604:251; Interrogation_Position=546; Antisense; CAACTGGTCTACTCGGCCGTGTTCA
>probe:Drosophila_2:1632556_s_at:678:289; Interrogation_Position=571; Antisense; CGGATGGCTTCGAGGTGACTTGCAA
>probe:Drosophila_2:1632556_s_at:463:95; Interrogation_Position=622; Antisense; AGATCCAGGGCGTGGGCAACATTGT
>probe:Drosophila_2:1632556_s_at:609:275; Interrogation_Position=683; Antisense; CTTCGACTTCATGGACTATCTGGTG
>probe:Drosophila_2:1632556_s_at:197:591; Interrogation_Position=775; Antisense; TGGTCTTTGCCTGGATCGCACTGCT
>probe:Drosophila_2:1632556_s_at:638:67; Interrogation_Position=803; Antisense; ATGGCTGCTCGTCTGCGTGATCAAT
>probe:Drosophila_2:1632556_s_at:683:513; Interrogation_Position=819; Antisense; GTGATCAATGTCGTCCAGCTGCGGC
>probe:Drosophila_2:1632556_s_at:664:81; Interrogation_Position=858; Antisense; AGGGTCTGAGTCCTGCCATGAATCG
>probe:Drosophila_2:1632556_s_at:597:433; Interrogation_Position=891; Antisense; GAGGTCCTCTACACTTTACATTCCA
>probe:Drosophila_2:1632556_s_at:70:651; Interrogation_Position=907; Antisense; TACATTCCACCTGTTCGCCTTTTAA
>probe:Drosophila_2:1632556_s_at:36:383; Interrogation_Position=965; Antisense; GAACGTCCACGTTATGAACGCATTG

Paste this into a BLAST search page for me
GATTATTCACATCGCAAGCCTTTTCGCCACCGTCATCTCGACAATAATGGAATAATGGCCGTCTACCAACTGGTCCAACTGGTCTACTCGGCCGTGTTCACGGATGGCTTCGAGGTGACTTGCAAAGATCCAGGGCGTGGGCAACATTGTCTTCGACTTCATGGACTATCTGGTGTGGTCTTTGCCTGGATCGCACTGCTATGGCTGCTCGTCTGCGTGATCAATGTGATCAATGTCGTCCAGCTGCGGCAGGGTCTGAGTCCTGCCATGAATCGGAGGTCCTCTACACTTTACATTCCATACATTCCACCTGTTCGCCTTTTAAGAACGTCCACGTTATGAACGCATTG

Full Affymetrix probeset data:

Annotations for 1632556_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime