Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632557_s_at:

>probe:Drosophila_2:1632557_s_at:476:283; Interrogation_Position=1404; Antisense; CTGTTCATGCTTAAGGGTTTATTAT
>probe:Drosophila_2:1632557_s_at:647:603; Interrogation_Position=1452; Antisense; TGATTATTTCTGTATCCCCTTTGGT
>probe:Drosophila_2:1632557_s_at:15:449; Interrogation_Position=1528; Antisense; GATCCTATGGGAAACTAGCTGTCAA
>probe:Drosophila_2:1632557_s_at:13:335; Interrogation_Position=1545; Antisense; GCTGTCAATGACTAAGGATGCTAAA
>probe:Drosophila_2:1632557_s_at:177:727; Interrogation_Position=1573; Antisense; TTGTGTTACAAGAACTCCATTGGAG
>probe:Drosophila_2:1632557_s_at:633:1; Interrogation_Position=1591; Antisense; ATTGGAGGTGTTTAAGACCGCCTGA
>probe:Drosophila_2:1632557_s_at:183:413; Interrogation_Position=1606; Antisense; GACCGCCTGATTTTCTTGATTTGTA
>probe:Drosophila_2:1632557_s_at:2:409; Interrogation_Position=1638; Antisense; GACGTATGTATTGATCTGATTATGG
>probe:Drosophila_2:1632557_s_at:145:65; Interrogation_Position=1659; Antisense; ATGGATCGTTTACCAAGTGAGCATC
>probe:Drosophila_2:1632557_s_at:202:513; Interrogation_Position=1675; Antisense; GTGAGCATCACAGCCAATGCTACGA
>probe:Drosophila_2:1632557_s_at:34:51; Interrogation_Position=1719; Antisense; ATGCTAGACTCACCATTTAGTTTAT
>probe:Drosophila_2:1632557_s_at:53:245; Interrogation_Position=1751; Antisense; AATTCCCAAGGAGTATTGCATGTTT
>probe:Drosophila_2:1632557_s_at:606:1; Interrogation_Position=1849; Antisense; ATTAATGTGCAATCTTTGGTAATGC
>probe:Drosophila_2:1632557_s_at:431:709; Interrogation_Position=1902; Antisense; TTAAGGTGATTTTATGACATTCCAA

Paste this into a BLAST search page for me
CTGTTCATGCTTAAGGGTTTATTATTGATTATTTCTGTATCCCCTTTGGTGATCCTATGGGAAACTAGCTGTCAAGCTGTCAATGACTAAGGATGCTAAATTGTGTTACAAGAACTCCATTGGAGATTGGAGGTGTTTAAGACCGCCTGAGACCGCCTGATTTTCTTGATTTGTAGACGTATGTATTGATCTGATTATGGATGGATCGTTTACCAAGTGAGCATCGTGAGCATCACAGCCAATGCTACGAATGCTAGACTCACCATTTAGTTTATAATTCCCAAGGAGTATTGCATGTTTATTAATGTGCAATCTTTGGTAATGCTTAAGGTGATTTTATGACATTCCAA

Full Affymetrix probeset data:

Annotations for 1632557_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime