FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632558_at:

>probe:Drosophila_2:1632558_at:82:267; Interrogation_Position=111; Antisense; CAGGACATCGGCTACCAGGAAAACA
>probe:Drosophila_2:1632558_at:573:261; Interrogation_Position=134; Antisense; CAGCAAGTGCCAGCGGGCCTCGAAG
>probe:Drosophila_2:1632558_at:616:587; Interrogation_Position=14; Antisense; TGAACTCGTGCCTCTAGTCGGATTC
>probe:Drosophila_2:1632558_at:143:379; Interrogation_Position=155; Antisense; GAAGCTCTGCTGCTCCCAGAGAAAT
>probe:Drosophila_2:1632558_at:191:335; Interrogation_Position=163; Antisense; GCTGCTCCCAGAGAAATATTGGATC
>probe:Drosophila_2:1632558_at:644:689; Interrogation_Position=179; Antisense; TATTGGATCCCAGTACGAATGTTTC
>probe:Drosophila_2:1632558_at:72:91; Interrogation_Position=190; Antisense; AGTACGAATGTTTCCATCACCACGG
>probe:Drosophila_2:1632558_at:267:35; Interrogation_Position=205; Antisense; ATCACCACGGCTGCAGCGAGAACAT
>probe:Drosophila_2:1632558_at:441:107; Interrogation_Position=223; Antisense; AGAACATCGCGACCATTATCTCAAC
>probe:Drosophila_2:1632558_at:542:413; Interrogation_Position=233; Antisense; GACCATTATCTCAACCTGCTCCTAG
>probe:Drosophila_2:1632558_at:318:87; Interrogation_Position=29; Antisense; AGTCGGATTCTCACCGCCCGTGTTT
>probe:Drosophila_2:1632558_at:171:71; Interrogation_Position=68; Antisense; AGGCCGTCGTCCGTCATCCAGGAAA
>probe:Drosophila_2:1632558_at:611:495; Interrogation_Position=80; Antisense; GTCATCCAGGAAAGGCGCCTTCCAG
>probe:Drosophila_2:1632558_at:691:719; Interrogation_Position=99; Antisense; TTCCAGTTTCCCCAGGACATCGGCT

Paste this into a BLAST search page for me
CAGGACATCGGCTACCAGGAAAACACAGCAAGTGCCAGCGGGCCTCGAAGTGAACTCGTGCCTCTAGTCGGATTCGAAGCTCTGCTGCTCCCAGAGAAATGCTGCTCCCAGAGAAATATTGGATCTATTGGATCCCAGTACGAATGTTTCAGTACGAATGTTTCCATCACCACGGATCACCACGGCTGCAGCGAGAACATAGAACATCGCGACCATTATCTCAACGACCATTATCTCAACCTGCTCCTAGAGTCGGATTCTCACCGCCCGTGTTTAGGCCGTCGTCCGTCATCCAGGAAAGTCATCCAGGAAAGGCGCCTTCCAGTTCCAGTTTCCCCAGGACATCGGCT

Full Affymetrix probeset data:

Annotations for 1632558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720