Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632559_at:

>probe:Drosophila_2:1632559_at:245:111; Interrogation_Position=6110; Antisense; AGAATCCCCTTTCGCTGGAAGTCAT
>probe:Drosophila_2:1632559_at:623:311; Interrogation_Position=6136; Antisense; GCCAACATTTGCCTGGGCTTTGATA
>probe:Drosophila_2:1632559_at:291:341; Interrogation_Position=6152; Antisense; GCTTTGATATACACTTGCCGCAGAT
>probe:Drosophila_2:1632559_at:345:197; Interrogation_Position=6181; Antisense; AACGGCATTCTGAAGCGCATGGTCA
>probe:Drosophila_2:1632559_at:616:603; Interrogation_Position=6206; Antisense; TGTTCCATATGGTGCGCGAGCTGAA
>probe:Drosophila_2:1632559_at:636:381; Interrogation_Position=6228; Antisense; GAACGCCTTGTTGGATGTACTCAGC
>probe:Drosophila_2:1632559_at:728:35; Interrogation_Position=6263; Antisense; ATCTACTTCACCTGGATGGACTGGC
>probe:Drosophila_2:1632559_at:565:69; Interrogation_Position=6290; Antisense; AGGCCTGGGACTATGTGCTCTGCCA
>probe:Drosophila_2:1632559_at:359:197; Interrogation_Position=6325; Antisense; AACGCAGTCGAGCTACGATCCTTTA
>probe:Drosophila_2:1632559_at:355:375; Interrogation_Position=6355; Antisense; GAAGAGGTGCTCCACAAGACGCTGC
>probe:Drosophila_2:1632559_at:161:99; Interrogation_Position=6521; Antisense; AGATGATACATTCCCATCCGGTGGA
>probe:Drosophila_2:1632559_at:252:415; Interrogation_Position=6544; Antisense; GAGAACCTTCGGCAACAGATCTTGG
>probe:Drosophila_2:1632559_at:325:215; Interrogation_Position=6575; Antisense; AAGATGCTGGTATTTTGCCGGTGGT
>probe:Drosophila_2:1632559_at:147:535; Interrogation_Position=6597; Antisense; GGTGCTGAACTTTGCGCTCAAGGAA

Paste this into a BLAST search page for me
AGAATCCCCTTTCGCTGGAAGTCATGCCAACATTTGCCTGGGCTTTGATAGCTTTGATATACACTTGCCGCAGATAACGGCATTCTGAAGCGCATGGTCATGTTCCATATGGTGCGCGAGCTGAAGAACGCCTTGTTGGATGTACTCAGCATCTACTTCACCTGGATGGACTGGCAGGCCTGGGACTATGTGCTCTGCCAAACGCAGTCGAGCTACGATCCTTTAGAAGAGGTGCTCCACAAGACGCTGCAGATGATACATTCCCATCCGGTGGAGAGAACCTTCGGCAACAGATCTTGGAAGATGCTGGTATTTTGCCGGTGGTGGTGCTGAACTTTGCGCTCAAGGAA

Full Affymetrix probeset data:

Annotations for 1632559_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime