Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632560_at:

>probe:Drosophila_2:1632560_at:441:671; Interrogation_Position=1953; Antisense; TACGGGACATCCTTTGCAAACAGAG
>probe:Drosophila_2:1632560_at:275:73; Interrogation_Position=1994; Antisense; AGGAACCTGCCGTGGTGACCACAGA
>probe:Drosophila_2:1632560_at:31:725; Interrogation_Position=2027; Antisense; TTGCTCCAGCTGAGACAACTGTGGT
>probe:Drosophila_2:1632560_at:195:195; Interrogation_Position=2043; Antisense; AACTGTGGTTCCTGTGGTGGTGCCC
>probe:Drosophila_2:1632560_at:176:299; Interrogation_Position=2067; Antisense; CGCTACGATTGCACCACTTGGAACT
>probe:Drosophila_2:1632560_at:553:695; Interrogation_Position=2157; Antisense; TTCCTTGGCTACAGAGACACCTACA
>probe:Drosophila_2:1632560_at:155:299; Interrogation_Position=2287; Antisense; CCGACGTCGGCCATAAATGTTTACA
>probe:Drosophila_2:1632560_at:637:167; Interrogation_Position=2301; Antisense; AAATGTTTACACCACTCCCGATGGA
>probe:Drosophila_2:1632560_at:62:137; Interrogation_Position=2344; Antisense; ACGAAGCCATCGGTCACGGAGAGCA
>probe:Drosophila_2:1632560_at:721:433; Interrogation_Position=2380; Antisense; GAGGGCACAAATACGGTCTCCACCG
>probe:Drosophila_2:1632560_at:242:227; Interrogation_Position=2437; Antisense; AAGGCAGGCGATGTCGATTGCATCA
>probe:Drosophila_2:1632560_at:654:637; Interrogation_Position=2450; Antisense; TCGATTGCATCAAGCTGGGCTGCTA
>probe:Drosophila_2:1632560_at:245:619; Interrogation_Position=2470; Antisense; TGCTACAACGGTGGCACCTGCGTAA
>probe:Drosophila_2:1632560_at:191:283; Interrogation_Position=2487; Antisense; CTGCGTAACCACATCCGAAGGATCG

Paste this into a BLAST search page for me
TACGGGACATCCTTTGCAAACAGAGAGGAACCTGCCGTGGTGACCACAGATTGCTCCAGCTGAGACAACTGTGGTAACTGTGGTTCCTGTGGTGGTGCCCCGCTACGATTGCACCACTTGGAACTTTCCTTGGCTACAGAGACACCTACACCGACGTCGGCCATAAATGTTTACAAAATGTTTACACCACTCCCGATGGAACGAAGCCATCGGTCACGGAGAGCAGAGGGCACAAATACGGTCTCCACCGAAGGCAGGCGATGTCGATTGCATCATCGATTGCATCAAGCTGGGCTGCTATGCTACAACGGTGGCACCTGCGTAACTGCGTAACCACATCCGAAGGATCG

Full Affymetrix probeset data:

Annotations for 1632560_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime