FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632561_at:

>probe:Drosophila_2:1632561_at:494:529; Interrogation_Position=2216; Antisense; GGGATCATCTGACATCTTTGGTCGA
>probe:Drosophila_2:1632561_at:440:243; Interrogation_Position=2244; Antisense; AATATCATACATATCACCACCGGCA
>probe:Drosophila_2:1632561_at:489:161; Interrogation_Position=2282; Antisense; AAATTGACGACATTCCTCCCGAATA
>probe:Drosophila_2:1632561_at:429:681; Interrogation_Position=2373; Antisense; TATACCACTTGGAGCTATTGTTGAA
>probe:Drosophila_2:1632561_at:358:365; Interrogation_Position=2427; Antisense; GAATCTTAGTCACCCATTTCATTTG
>probe:Drosophila_2:1632561_at:54:19; Interrogation_Position=2442; Antisense; ATTTCATTTGCATGGCACTGCGTTT
>probe:Drosophila_2:1632561_at:476:59; Interrogation_Position=2468; Antisense; ATGTTGTCGGACTAGGTCGATCGCC
>probe:Drosophila_2:1632561_at:586:535; Interrogation_Position=2482; Antisense; GGTCGATCGCCGGATAAGTCAATAA
>probe:Drosophila_2:1632561_at:482:275; Interrogation_Position=2554; Antisense; CTTGAGCGTCATTTTTCTAAGCCCC
>probe:Drosophila_2:1632561_at:385:455; Interrogation_Position=2587; Antisense; GATACCATAGCCGTTCCTAACAATG
>probe:Drosophila_2:1632561_at:414:59; Interrogation_Position=2615; Antisense; ATGTTGTAATCCGTTTTCGCGCAGA
>probe:Drosophila_2:1632561_at:1:495; Interrogation_Position=2666; Antisense; GTCACTTCCTTTTTCATATCGTCAT
>probe:Drosophila_2:1632561_at:707:21; Interrogation_Position=2711; Antisense; ATATCGGTACTACAGCTGACCTGCC
>probe:Drosophila_2:1632561_at:679:597; Interrogation_Position=2772; Antisense; TGTGCCGCCGGTTACATGGTACTAG

Paste this into a BLAST search page for me
GGGATCATCTGACATCTTTGGTCGAAATATCATACATATCACCACCGGCAAAATTGACGACATTCCTCCCGAATATATACCACTTGGAGCTATTGTTGAAGAATCTTAGTCACCCATTTCATTTGATTTCATTTGCATGGCACTGCGTTTATGTTGTCGGACTAGGTCGATCGCCGGTCGATCGCCGGATAAGTCAATAACTTGAGCGTCATTTTTCTAAGCCCCGATACCATAGCCGTTCCTAACAATGATGTTGTAATCCGTTTTCGCGCAGAGTCACTTCCTTTTTCATATCGTCATATATCGGTACTACAGCTGACCTGCCTGTGCCGCCGGTTACATGGTACTAG

Full Affymetrix probeset data:

Annotations for 1632561_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720