FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632564_at:

>probe:Drosophila_2:1632564_at:224:591; Interrogation_Position=1028; Antisense; TGGTCAAGTCACTGCAGATCACCTT
>probe:Drosophila_2:1632564_at:176:101; Interrogation_Position=1095; Antisense; AGAGGTCCTGCGGATTGTCAACCAG
>probe:Drosophila_2:1632564_at:283:419; Interrogation_Position=1147; Antisense; GAGCTCCTAATGTTCACCTATTGTG
>probe:Drosophila_2:1632564_at:370:383; Interrogation_Position=1174; Antisense; GAACTCCTCAGTCGGCATAGTATTC
>probe:Drosophila_2:1632564_at:16:25; Interrogation_Position=1190; Antisense; ATAGTATTCGATCTGGCGACGCCTT
>probe:Drosophila_2:1632564_at:730:529; Interrogation_Position=684; Antisense; GGGATCACTGTTTGTCACCCTGAGC
>probe:Drosophila_2:1632564_at:547:609; Interrogation_Position=704; Antisense; TGAGCCTGCTACTCCTGGGACAATT
>probe:Drosophila_2:1632564_at:211:63; Interrogation_Position=731; Antisense; ATGTGCTCTACTGCAGCCTGAAGAA
>probe:Drosophila_2:1632564_at:500:375; Interrogation_Position=750; Antisense; GAAGAACCTGGATGCCCATACCAAG
>probe:Drosophila_2:1632564_at:342:169; Interrogation_Position=795; Antisense; AAATGGCCTGAGTTCGCTGCAAGAG
>probe:Drosophila_2:1632564_at:562:239; Interrogation_Position=853; Antisense; AATCAGTACGTTTTGCTCCAGGAGC
>probe:Drosophila_2:1632564_at:311:347; Interrogation_Position=876; Antisense; GCATCCGACGGATCTGCTGAGATTG
>probe:Drosophila_2:1632564_at:371:201; Interrogation_Position=943; Antisense; AACGCCTTGGTGGAATGCATTCGCT
>probe:Drosophila_2:1632564_at:572:11; Interrogation_Position=979; Antisense; ATTCTGCACTGCTCACAGGAGTTGG

Paste this into a BLAST search page for me
TGGTCAAGTCACTGCAGATCACCTTAGAGGTCCTGCGGATTGTCAACCAGGAGCTCCTAATGTTCACCTATTGTGGAACTCCTCAGTCGGCATAGTATTCATAGTATTCGATCTGGCGACGCCTTGGGATCACTGTTTGTCACCCTGAGCTGAGCCTGCTACTCCTGGGACAATTATGTGCTCTACTGCAGCCTGAAGAAGAAGAACCTGGATGCCCATACCAAGAAATGGCCTGAGTTCGCTGCAAGAGAATCAGTACGTTTTGCTCCAGGAGCGCATCCGACGGATCTGCTGAGATTGAACGCCTTGGTGGAATGCATTCGCTATTCTGCACTGCTCACAGGAGTTGG

Full Affymetrix probeset data:

Annotations for 1632564_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720