FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632565_at:

>probe:Drosophila_2:1632565_at:638:5; Interrogation_Position=180; Antisense; ATTGACCGCGAGAAGACCTGTCCTA
>probe:Drosophila_2:1632565_at:425:515; Interrogation_Position=214; Antisense; GTGTCTTCTGCTCTACGGGACGACA
>probe:Drosophila_2:1632565_at:518:549; Interrogation_Position=251; Antisense; GGAGTATATGTTCGGCAACGTGCCC
>probe:Drosophila_2:1632565_at:670:293; Interrogation_Position=281; Antisense; CGAGCTTCAGATTTACACCTGGCAA
>probe:Drosophila_2:1632565_at:241:137; Interrogation_Position=319; Antisense; ACGAACTGACCTCTCTGGTGCGAGA
>probe:Drosophila_2:1632565_at:670:591; Interrogation_Position=334; Antisense; TGGTGCGAGACGTCAATCCGGACAC
>probe:Drosophila_2:1632565_at:28:373; Interrogation_Position=365; Antisense; GAAGGGCACCTACTTTGACTTTGCT
>probe:Drosophila_2:1632565_at:120:723; Interrogation_Position=379; Antisense; TTGACTTTGCTGTCGTGTACCCCAA
>probe:Drosophila_2:1632565_at:729:485; Interrogation_Position=394; Antisense; TGTACCCCAACTTCCGGAGTAATCA
>probe:Drosophila_2:1632565_at:531:33; Interrogation_Position=415; Antisense; ATCACTTCCAGATGCGCGAAATCGG
>probe:Drosophila_2:1632565_at:576:283; Interrogation_Position=431; Antisense; CGAAATCGGAGTGACCTGCACGGGT
>probe:Drosophila_2:1632565_at:673:105; Interrogation_Position=478; Antisense; AGACACTTGCTCAGGCCAAATTCAG
>probe:Drosophila_2:1632565_at:343:403; Interrogation_Position=510; Antisense; GACTTTCTGGACATCTCGATTACTC
>probe:Drosophila_2:1632565_at:89:499; Interrogation_Position=571; Antisense; GTCCGTACTGATTCTTCACTTTCAT

Paste this into a BLAST search page for me
ATTGACCGCGAGAAGACCTGTCCTAGTGTCTTCTGCTCTACGGGACGACAGGAGTATATGTTCGGCAACGTGCCCCGAGCTTCAGATTTACACCTGGCAAACGAACTGACCTCTCTGGTGCGAGATGGTGCGAGACGTCAATCCGGACACGAAGGGCACCTACTTTGACTTTGCTTTGACTTTGCTGTCGTGTACCCCAATGTACCCCAACTTCCGGAGTAATCAATCACTTCCAGATGCGCGAAATCGGCGAAATCGGAGTGACCTGCACGGGTAGACACTTGCTCAGGCCAAATTCAGGACTTTCTGGACATCTCGATTACTCGTCCGTACTGATTCTTCACTTTCAT

Full Affymetrix probeset data:

Annotations for 1632565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720