FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632566_at:

>probe:Drosophila_2:1632566_at:5:39; Interrogation_Position=2183; Antisense; ATCTCGCACTCTTTGAGCCAGAGCA
>probe:Drosophila_2:1632566_at:633:657; Interrogation_Position=2236; Antisense; TAAGCAGATCCGACTCTCCATAATG
>probe:Drosophila_2:1632566_at:164:33; Interrogation_Position=2255; Antisense; ATAATGCTCTTCTTTTTGCTGGGTC
>probe:Drosophila_2:1632566_at:308:285; Interrogation_Position=2273; Antisense; CTGGGTCTTACCTGGATCTTTGGAA
>probe:Drosophila_2:1632566_at:5:365; Interrogation_Position=2295; Antisense; GAATATTCGCCTTCATGCAGGCAGG
>probe:Drosophila_2:1632566_at:233:349; Interrogation_Position=2311; Antisense; GCAGGCAGGTGTGGCTTTTTCATAC
>probe:Drosophila_2:1632566_at:37:651; Interrogation_Position=2346; Antisense; TCACGGCCACTATGCAGGGATTTGT
>probe:Drosophila_2:1632566_at:623:471; Interrogation_Position=2374; Antisense; GTTCATTTACTTTGTCCTCTTGGAC
>probe:Drosophila_2:1632566_at:391:459; Interrogation_Position=2428; Antisense; GATTTGCCCCACCAAGATGGAGCTG
>probe:Drosophila_2:1632566_at:65:549; Interrogation_Position=2452; Antisense; GGATGTCCAAAAGCGCACCACTGAG
>probe:Drosophila_2:1632566_at:701:463; Interrogation_Position=2608; Antisense; GATTGCCATTATGTATAGGTCCCTA
>probe:Drosophila_2:1632566_at:409:241; Interrogation_Position=2667; Antisense; CAATACTTCCCAGCGAGTCGATTTA
>probe:Drosophila_2:1632566_at:91:17; Interrogation_Position=2710; Antisense; ATTTTCGCATGTAAGTCTCTGTCAG
>probe:Drosophila_2:1632566_at:694:497; Interrogation_Position=2724; Antisense; GTCTCTGTCAGAAGCCAACTATTTA

Paste this into a BLAST search page for me
ATCTCGCACTCTTTGAGCCAGAGCATAAGCAGATCCGACTCTCCATAATGATAATGCTCTTCTTTTTGCTGGGTCCTGGGTCTTACCTGGATCTTTGGAAGAATATTCGCCTTCATGCAGGCAGGGCAGGCAGGTGTGGCTTTTTCATACTCACGGCCACTATGCAGGGATTTGTGTTCATTTACTTTGTCCTCTTGGACGATTTGCCCCACCAAGATGGAGCTGGGATGTCCAAAAGCGCACCACTGAGGATTGCCATTATGTATAGGTCCCTACAATACTTCCCAGCGAGTCGATTTAATTTTCGCATGTAAGTCTCTGTCAGGTCTCTGTCAGAAGCCAACTATTTA

Full Affymetrix probeset data:

Annotations for 1632566_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720