Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632567_at:

>probe:Drosophila_2:1632567_at:165:335; Interrogation_Position=3124; Antisense; GCTGCGCGGCTACAAGGATTACTTA
>probe:Drosophila_2:1632567_at:505:543; Interrogation_Position=3139; Antisense; GGATTACTTAGTGCAGTGTAGCGTT
>probe:Drosophila_2:1632567_at:346:665; Interrogation_Position=3275; Antisense; TACACCATATGTATAGCTGACACTT
>probe:Drosophila_2:1632567_at:288:117; Interrogation_Position=3289; Antisense; AGCTGACACTTTGAAGGGCTACCAA
>probe:Drosophila_2:1632567_at:197:519; Interrogation_Position=3304; Antisense; GGGCTACCAAATTTACACCTCGAAT
>probe:Drosophila_2:1632567_at:716:153; Interrogation_Position=3318; Antisense; ACACCTCGAATTTGTTTAGATGCGG
>probe:Drosophila_2:1632567_at:228:471; Interrogation_Position=3386; Antisense; GTTAACATATACACGCGTAACCCTT
>probe:Drosophila_2:1632567_at:662:195; Interrogation_Position=3419; Antisense; AACTGTGCAACTTAGTATCCTTATG
>probe:Drosophila_2:1632567_at:281:307; Interrogation_Position=3437; Antisense; CCTTATGCAATATTGGAGTGCCTCT
>probe:Drosophila_2:1632567_at:291:433; Interrogation_Position=3452; Antisense; GAGTGCCTCTGATTTTGTTCATTGA
>probe:Drosophila_2:1632567_at:600:465; Interrogation_Position=3478; Antisense; GTTGTTTTCTTTCATGTTTTCATTT
>probe:Drosophila_2:1632567_at:151:271; Interrogation_Position=3519; Antisense; CATACGCATCTGTCGTAACATATAA
>probe:Drosophila_2:1632567_at:699:655; Interrogation_Position=3623; Antisense; TAAGTTTCCGTGTGTTATTTCGATA
>probe:Drosophila_2:1632567_at:298:13; Interrogation_Position=3669; Antisense; ATTCATTAAAGCAATTCCACGCAAA

Paste this into a BLAST search page for me
GCTGCGCGGCTACAAGGATTACTTAGGATTACTTAGTGCAGTGTAGCGTTTACACCATATGTATAGCTGACACTTAGCTGACACTTTGAAGGGCTACCAAGGGCTACCAAATTTACACCTCGAATACACCTCGAATTTGTTTAGATGCGGGTTAACATATACACGCGTAACCCTTAACTGTGCAACTTAGTATCCTTATGCCTTATGCAATATTGGAGTGCCTCTGAGTGCCTCTGATTTTGTTCATTGAGTTGTTTTCTTTCATGTTTTCATTTCATACGCATCTGTCGTAACATATAATAAGTTTCCGTGTGTTATTTCGATAATTCATTAAAGCAATTCCACGCAAA

Full Affymetrix probeset data:

Annotations for 1632567_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime