FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632568_at:

>probe:Drosophila_2:1632568_at:145:555; Interrogation_Position=1018; Antisense; GGAGCCATCAGCAGCGGATCCATAT
>probe:Drosophila_2:1632568_at:248:547; Interrogation_Position=1033; Antisense; GGATCCATATCCTCAGAGTTGCTCC
>probe:Drosophila_2:1632568_at:702:699; Interrogation_Position=1077; Antisense; TTTTCAGTCCCTGTCGCAGGATCAA
>probe:Drosophila_2:1632568_at:263:33; Interrogation_Position=1097; Antisense; ATCAACCGGCGCCTGTGGAGAACAT
>probe:Drosophila_2:1632568_at:208:225; Interrogation_Position=1139; Antisense; AAGGACCAGTACCAGAGCAAGCCGC
>probe:Drosophila_2:1632568_at:91:265; Interrogation_Position=1166; Antisense; CAGCACCAGCCGATGATGTAGATGA
>probe:Drosophila_2:1632568_at:237:105; Interrogation_Position=1206; Antisense; AGACGACAGTGATGTGCTGCCACGC
>probe:Drosophila_2:1632568_at:328:695; Interrogation_Position=1249; Antisense; TTCACCGAACAACTGCGTACCATGG
>probe:Drosophila_2:1632568_at:105:65; Interrogation_Position=1279; Antisense; ATGGGCTTCATTAATCACACTCAGA
>probe:Drosophila_2:1632568_at:39:475; Interrogation_Position=1310; Antisense; GTTATCTAGAACTTTCCGATGGGAA
>probe:Drosophila_2:1632568_at:380:561; Interrogation_Position=1338; Antisense; GGAACACGCTATTAATCTGCTTATG
>probe:Drosophila_2:1632568_at:57:63; Interrogation_Position=1410; Antisense; ATGTGCTTACTTTACGGACTTATAT
>probe:Drosophila_2:1632568_at:38:559; Interrogation_Position=1425; Antisense; GGACTTATATTTATTCTGCTGCTGA
>probe:Drosophila_2:1632568_at:425:1; Interrogation_Position=941; Antisense; ATGAAAGACCTAGAACCACCTCGGC

Paste this into a BLAST search page for me
GGAGCCATCAGCAGCGGATCCATATGGATCCATATCCTCAGAGTTGCTCCTTTTCAGTCCCTGTCGCAGGATCAAATCAACCGGCGCCTGTGGAGAACATAAGGACCAGTACCAGAGCAAGCCGCCAGCACCAGCCGATGATGTAGATGAAGACGACAGTGATGTGCTGCCACGCTTCACCGAACAACTGCGTACCATGGATGGGCTTCATTAATCACACTCAGAGTTATCTAGAACTTTCCGATGGGAAGGAACACGCTATTAATCTGCTTATGATGTGCTTACTTTACGGACTTATATGGACTTATATTTATTCTGCTGCTGAATGAAAGACCTAGAACCACCTCGGC

Full Affymetrix probeset data:

Annotations for 1632568_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720